There has been a massive repetition by Darwinists of an untrue claim that human genomes and chimp genomes are 98% or 98.6% the same. But a 2005 paper had the title "Eighty percent of proteins are different between humans and chimpanzees." A 2021 study found that "1.5% to 7% of the human genome is unique to Homo sapiens," suggesting the claim of 98% similarity was probably in error. The study "An ancestral recombination graph of human, Neanderthal, and Denisovan genomes" published in the journal Science states, "We find that only 1.5 to 7% of the modern human genome is uniquely human," and later states, "We find that approximately 7% of the human autosomal genome is human-unique and free of both admixture and ILS." A 2002 paper is entitled "Divergence between samples of chimpanzee and human DNA sequences is 5%, counting indels."
The year 2025 paper analyzed by Luskin is "Complete sequencing of ape genomes," which you can read here. It reports in its Supplementary Figure III.12 (row 7 and row 8) that according to one measure, the difference between the human genome and the chimpanzee genome is about 12% or 13%. Luskin's posts (here and here) clarify that when we add this difference to another difference reported in the same paper, we are left with a roughly 14% difference between the human genome and the chimpanzee genome. Our mainstream biology authorities again and again told us an untrue claim that our genomes are 98.6% the same as that of chimpanzees, a claim that they wanted to believe, but which was wrong by a factor of 10.
A recent series of articles at the Evolution News site are promoting a book by David Klinghoffer, one entitled "Plato's Revenge: The New Science of the Immaterial Genome." I have not read the book, but from reading several of the articles promoting the book, such as this one and this one, I can get a rough idea of the line of reasoning that Klinghoffer is attempting. The line of reasoning seems to go like this:
(1) Some reasoning is used to present the idea that the human genome (our DNA) does not have anything close to the amount of information needed to specify a human organism. The reasoning revolves around the claim that you would need something much bigger than DNA to specify how to make a human body.
(2) Such reasoning is used to launch the idea that there is an "immaterial genome," a specification for how to make a human being, that somehow exists in some transcendent sense, rather like the platonic forms postulated by the ancient philosopher Plato.
(3) The existence of such a transcendent specification of a human is suggested as some solution to the problem of explaining how a human body arises.
I think that such reasoning is a "hit and miss" affair that is a mixture of an extremely important insight, and also maybe one or two mistakes. The extremely important insight is that the human genome is very much insufficient to specify how to make a human body. But the approach of trying to establish such a claim mainly by making an argument based on information quantity is a clumsy one. A much better way to establish such a claim is by referring to the content of the genome, not its quantity.
What is the content of human DNA, the human genome? DNA consists of only very low-level chemical information such as information specifying which amino acids make up a protein. The best way to understand what is in DNA is to study the only coding system that has ever been discovered in DNA, what is called the genetic code. The genetic code is depicted in the diagram below.
The letters A, C, T and G in the diagram specify different types of nucleotide base pairs found in DNA. A stands for adenine, C stands for cytosine, T stands for thymine, and G stands for guanine. DNA is a long string-like molecule. A particular section of DNA may consist of some combination of these four chemicals. So some tiny fraction of DNA may look like this:
ATCGCATTACGTATGGCATTACGT
And some other tiny fraction of DNA may look like this:
CTGGCATTACGAATGGCATTACGT
Particular triple combinations of such chemicals symbolize particular amino acids, using the system shown in the circle diagram above. So in DNA particular sequences of three of these chemicals may symbolize one of the twenty amino acids shown below, the twenty amino acids used by living things:
The 20 amino acids used by human bodies (Credit: Wikipedia Commons)
The relationship between amino acids, polypeptide chains, and protein molecules is illustrated by the diagram below:
The human body uses more than 20,000 different types of protein molecules, each of which has a particular 3D shape. Does a mere sequence of amino acids guarantee that some particular 3D shape will arise once that sequence exists? There is no good evidence that such a thing is true. There is a dogma in biology called Anfinsen's Dogma, claiming that the three-dimensional shape of a protein molecule arises automatically once a particular polypeptide sequence exists. The dogma is not credible, and was never well-established by experiments. Anfinsen did some experiments that he claimed supported such a dogma. But his experiments never really established any such dogma, and his experiments have failed to replicate. See my two posts here for why Anfinsen's Dogma is not well-established, and also not believable.
What is crystal-clear is that DNA does not specify anything bigger than a polypeptide sequence or a protein molecule. But human bodies have a vast hierarchical organization involving many different levels of organization, and a protein molecule is near the bottom of such a hierarchy. It works like this: amino acids are organized into polypeptide chains, which are organized into protein molecules, which are organized into protein complexes, which are organized into organelles, which are organized into cells, which are organized into tissues, which are organized into organ systems, which (along with the skeletal system) are the main parts of the human body. DNA only specifies the lowest levels of such organization.
DNA does not specify how to make a protein complex (a specific arrangement of proteins serving a functional purpose). DNA does not specify how to make the organelles that are the building components of cells. DNA does not specify how to make cells. DNA does not specify how to make tissue. DNA does not how to specify how to make organs. DNA does not specify how to specify how to make organ systems. DNA contains no anatomy information at all. Read my post here for a list of quotes by dozens of scientists or medical authorities who confess that DNA is no blueprint, recipe or program for making a human body.
The diagram below specifies levels of organization in the human body, and which levels are not specified by DNA:
Among the layers of organization depicted above is the layer of protein complexes, which involves endless examples of particular types of protein molecules magically forming into accidentally unachievable arrangements so complex they are widely called "molecular machines" in mainstream biology literature. One example is shown below, a microscopic device including seven propellers.
(Image credit: Wikipedia Commons, derived from Yuan et al. 2010, Structure of an apoptosome-procaspase-9 CARD complex)
But what about the idea of postulating an "immaterial genome" that has such a specification, outside of the human body, as Klinghoffer has done? I think he has had a very important insight, that there must exist some specification or understanding of how to make a human body, one that exists beyond the physical reality of a human body. But I find the use of the term "immaterial genome" to be a very regrettable term. The term "genome" should be limited to what is in DNA or the human body.
Consider the brain. There are a host of reasons why the human brain is utterly insufficient to explain human mental phenomena such as self-hood, thinking, imagination and memory. Such reasons are explained on my website here. Should we then start talking about an "immaterial brain" to explain how humans get minds? The use of such a term would be very regrettable. It is much better to use terms such as "soul" or "spirit" or "mind." When talking about the brain, the term "brain" should be restricted to mean only the physical matter in the skull of a person. That way you can very clearly talk about what is and is not in the brain.
Just as it is clumsy and inappropriate to use the term "immaterial brain" when talking about the need to specify a human soul or spirit, it is inappropriate to use the term "immaterial genome" to refer to some postulated non-material specification or understanding of how to make a human body. Such a thing is not a genome, and should not be called a genome.
I have one other objection to the summaries I have read of Klinghoffer's book. Such summaries seem to suggest that if there existed some immaterial or transcendent specification of how to make a human, that such a thing might explain how human bodies arise. I don't think that is correct. You could only explain the origin of a human body by postulating some type of agency that acted while using such a specification. Specifications do not build very complex things.
Consider a blueprint. If you merely dump some construction materials such as bricks, pipes, wire, floorboards and 2" by 4" wood beams at an empty construction lot, and also dump a blueprint next to such materials, that will not cause a house to be built. Blueprints do not build things. Things only get built with the help of blueprints when there is at least one intelligent agent to read blueprints, and get ideas about how to build things.
So imagine there was some immaterial specification for how to make a human body. That would not explain the construction of a human body. Low-level components such as protein molecules and organelles and cells would not be able to read such an enormously complex specification on how to build a body, and would not be able to get ideas from such a specification on how they should act to help achieve the construction of a human body.
Plato was the greatest writer of all the philosophers, and his Dialogues are some of the greatest masterpieces of philosophy. I've read every one of them. The philosophical idea that Plato kept advancing is that individual material instances are instantiations of a transcendent form or schema of some particular type. So according to such an idea, a material house is an instantiation of a transcendent Idea of a House or an immaterial Form of a House; and a material human is an instantiation of a transcendent Idea of a Human or an immaterial Form of a Human. A wikipedia.org article tells us this:
"According to this theory, Forms—conventionally capitalized and also commonly translated as Ideas—are the timeless, absolute, non-physical, and unchangeable essences of all things, which objects and matter in the physical world merely participate in, imitate, or resemble. In other words, Forms are various abstract ideals that exist even outside of human minds and that constitute the basis of reality."
But we cannot explain the origin of a human body by merely imagining that there is some transcendent schema of a human that somehow gets instantiated. That would not explain how a billion diverse details of organization get accomplished, and how endless millions of feats of precise biochemistry engineering get done.
To have a credible hypothesis of the origin of dynamic physical states of vast organization such as the human body, we must assume a purposeful top-down organizational effect. Given a lack of anything in a human body that explains the full reproduction of a human (not to be confused with mere pregnancy), it is utterly insufficient to assume that such a purposeful organizational effect merely acted in the past. We should assume that such a purposeful organizational effect acts continuously throughout all of our lives, and acts across all parts of the planet in which large superbly organized organisms exist. A good acronym to describe such a reality is the acronym GOAL, which stands for Global Organizing Activity of a Life-Force. Such an acronym is suitable, given the dramatically teleological and purposefulness of such an agency.
To read about the case for believing in such a reality, read my post "GOAL and Soul: Postulating What We Need to Explain Humans."
Throughout our lives many science professors have been attempting to brainwash us into believing the groundless doctrine that laws of physics and chemistry can explain everything in some mechanistic way. Nature never provided any warrant for such claims. The laws of physics and chemistry that can explain some lifeless and mindless phenomena such as gravity, lightning and freezing utterly fail when it comes to explaining the mind-boggling wonders of physical biological organization and the wonders of human minds, human mental capabilities and human mental experiences. There is a huge body of functional information in DNA, consisting mainly of specifications for which amino acids make up particular proteins. But physics and chemistry do not explain the origin of such information, which also is not credibly explained by any ideas of so-called natural selection or evolution (for reasons I discuss here and here). And that huge body of functional information in DNA is not even a hundredth of the information needed to have a specification of how to make a living human body. Once a full human body arises, you do not have an explanation for human minds and human memory, which are not credibly explained by brains, for reasons discussed at very great length at my site here. Evolution does not explain DNA; DNA does not explain bodies; and bodies do not explain minds.
Plato had no understanding of the vast hierarchical organization and enormously fine-tuned functional complexity of the human body, and its endless cases of component interdependence. What we need to postulate to credibly explain the arising of such organization and functional complexity during the nine months of pregnancy is a mind-boggling reality beyond anything Plato conceived.
Even though he seems to be using some poorly chosen terminology, Klinghoffer seems to merit praise for coming to the extremely important realization that human bodies do not contain any specification for how to build human bodies. Anyone who comes to that realization has made some very important progress, and has discovered one of what I call the Seven Main Clues About Reality (I suspect Klinghoffer has discovered several of these). For a discussion of these clues and their implications, read my post here.
Although not the best reason for rejecting claims that DNA is a specification for making a human, the reason involving the insufficient size of the human genome is still one of numerous reasons for rejecting such a claim. In my 2016 post "The Gigantic Missing Link of Biological Life," I explained six reasons for rejecting the claim that DNA is a specification for building a human body. The six reasons I listed were these:
Reason #1: The “language” used by DNA is a minimal feature-poor language lacking any grammar or capability for expressing anything like a blueprint, a recipe, a program or an algorithm for making a human being.
Reason #2: Even if the “language” used by DNA had the capability of expressing a blueprint or recipe or program for making a human, there would be nothing that we know of capable of interpreting such instructions.
Reason #3: Despite cataloging the entire human genome, and exhaustively analyzing it, scientists have not discovered any part of DNA where a blueprint of the human body or a recipe for making humans is stored.
Reason #4: If DNA stored a human blueprint or human recipe or body plan, humans would have a much larger DNA than simpler organisms; instead, the opposite is often true.
Reason #5: The DNA size of humans is insufficient to be a blueprint or recipe for the human body with all its complexities.
Reason #6: If DNA stored a recipe or blueprint for making humans, we would probably sometimes see extremely jumbled bodies resulting from mutations, but we don't see such “scrambled humans.”
I think these reasons have stood up extremely well over the nine years since I wrote that post, and I see no reason to modify any of them. Reason #5 was a claim that the human genome is not big enough to be a specification for making a human, a reason similar to the main reason Klinghoffer now gives for disbelieving that the genome can specify how to make a human. I regarded that Reason #5 as being less weighty that the first three reasons I gave. Here is what I said to back up that Reason #5 back in 2016:
"Astonishingly our biologists have sometimes assumed that DNA is a complete specification for constructing a human body, but I have never once read a biologist consider whether the information size of DNA is sufficient for such a task. The idea that DNA can store a complete specification for a human being will obviously make no sense if our DNA molecules are not big enough to store such a specification, just as it will make no sense to assume that a postcard can store the names of all members of a club if the club has many thousands of members.
It has been estimated that a DNA molecule has an information size of about 700 megabytes. This is not big enough to store a complete blueprint, algorithm, or program for creating a human being. If you use the uncompressed RAW files used in cameras, it will take about 8 megabytes to store a high resolution photo. This means human DNA has an information size needed to store about 100 high-resolution photos uncompressed. This is not big enough to store a complete specification for making the human body. A recently introduced CT scanner requires 320 scans to map a human body, each scan equivalent to such an 8 megabyte photo. But consider also all the microscopic functionality that would need to be specified, and all of the microscopic details. It would seem that it would require many gigabytes to store a complete plan for building a human, not just 700 megabytes."
Here is a very rough calculation you can make to show how ridiculously inadequate is 700 megabytes (the size of the human genome) to store all of the information needed to make a human body. It has been estimated that the human body has about 37 trillion cells. Now, let us completely ignore the vast amount of information required to specify the structure of such cells, and merely consider how much information is needed to specify the exact positions of each of them in the body. Humans have about 200 types of cells, and cells must be very precisely positioned. The right type of cell needs to be in the right position for the human body to work correctly.
Now to specify the mere position and cell type of any particular cell in the human body you would need at least four bytes per cell. Using a three-dimensional grid that was roughly 500 millimeters by 500 millimeters by 1000 millimeters, you would need at least four bytes per cell to specify a cell type and the three-dimensional position of each cell (assuming some very convenient notation system allowing you to specify a cell type by merely giving a number between 1 and 200). What would be the storage requirements needed to merely specify the positions and cell types for 37 trillion cells? It would be roughly 100 trillion bytes. But that would be a size roughly 100,000 times greater than the known size of the human genome.
In reality, the human genome (DNA) contains not a single particle of any such information. Nowhere in DNA is there any system allowing the specification of the three-dimensional position of anything. Nowhere in DNA is there any such thing as a specification of how to make a cell or any of the organelles that make up a cell. Nowhere in DNA is there any such thing as a notation system by which a cell type can be specified.






