Header 1

Our future, our universe, and other weighty topics


Saturday, May 31, 2025

Platonism Is No Fix for the Ocean-Sized Explanatory Shortfalls of Biology

 At the Evolution News web site (www.evolutionnews.org), there are some very good articles, that sometimes appear with other articles that may fail in one way or another.  Examples of its failing articles include its occasional off-topic articles that seem to argue against all forms of medical assistance in dying, articles that sound wrong because those in agony while dying from the most painful types of cancer should have a euthanasia option. Examples of the better offerings at the site were a recent set of articles (here and here and here) by Casey Luskin, which did a great job of clarifying the findings of an important scientific paper. 

There has been a massive repetition by Darwinists of an untrue claim that human genomes and chimp genomes are 98% or 98.6% the same. But a 2005 paper had the title "Eighty percent of proteins are different between humans and chimpanzees."  A 2021 study found that "1.5% to 7% of the human genome is unique to Homo sapiens," suggesting the claim of 98% similarity was probably in error. The study "An ancestral recombination graph of human, Neanderthal, and Denisovan genomes" published in the journal Science states, "We find that only 1.5 to 7% of the modern human genome is uniquely human," and later states, "We find that approximately 7% of the human autosomal genome is human-unique and free of both admixture and ILS."  A 2002 paper is entitled "Divergence between samples of chimpanzee and human DNA sequences is 5%, counting indels."  

The year 2025 paper analyzed by Luskin is "Complete sequencing of ape genomes," which you can read here. It reports in its Supplementary Figure III.12 (row 7 and row 8) that according to one measure, the difference between the human genome and the chimpanzee genome is about 12% or 13%. Luskin's posts  (here and here)  clarify that when we add this difference to another difference reported in the same paper, we are left with a  roughly 14% difference between the human genome and the chimpanzee genome. Our mainstream biology authorities again and again told us an untrue claim that our genomes are 98.6%  the same as that of chimpanzees, a claim that they wanted to believe, but which was wrong by a factor of 10. 

A recent series of articles at the Evolution News site are promoting a book by David Klinghoffer, one entitled "Plato's Revenge: The New Science of the Immaterial Genome." I have not read the book, but from reading several of the articles promoting the book, such as this one and this one, I can get a rough idea of the line of reasoning that Klinghoffer is attempting. The line of reasoning seems to go like this:

(1) Some reasoning is used to present the idea that the human genome (our DNA) does not have anything close to the amount of information needed to specify a human organism.  The reasoning revolves around the claim that you would need something much bigger than DNA to specify how to make a human body. 
(2) Such reasoning is used to launch the idea that there is an "immaterial genome," a specification for how to make a human being, that somehow exists in some transcendent sense, rather like the platonic forms postulated by the ancient philosopher Plato. 
(3) The existence of such a transcendent specification of a human is suggested as some solution to the problem of explaining how a human body arises. 

I think that such reasoning is a "hit and miss" affair that is a mixture of an extremely important insight, and also maybe one or two mistakes. The extremely important insight is that the human genome is very much insufficient to specify how to make a human body. But the approach of trying to establish such a claim mainly by making an argument based on information quantity is a clumsy one. A much better way to establish such a claim is by referring to the content of the genome, not its quantity. 

What is the content of human DNA, the human genome? DNA consists of only very low-level chemical information such as information specifying which amino acids make up a protein. The best way to understand what is in DNA is to study the only coding system that has ever been discovered in DNA, what is called the genetic code. The genetic code is depicted in the diagram below. 

The letters A, C, T and G in the diagram specify different types of nucleotide base pairs found in DNA. A stands for adenine, C stands for cytosine, T stands for thymine, and G stands for guanine. DNA is a long string-like molecule. A particular section of DNA may consist of some combination of these four chemicals. So some tiny fraction of DNA may look like this:

ATCGCATTACGTATGGCATTACGT

And some other tiny fraction of DNA may look like this:

CTGGCATTACGAATGGCATTACGT

Particular triple combinations of such chemicals symbolize particular amino acids, using the system shown in the circle diagram above. So in DNA particular sequences of three of these chemicals may symbolize one of the twenty amino acids shown below, the twenty amino acids used by living things:
 
amino acids
The 20 amino acids used by human bodies (Credit: Wikipedia Commons)

What is the largest thing that can be specified by a particular sequence of these chemicals (A, C, T and G, or adenine,  cytosine,  thymine, and guanine) in DNA? The largest thing that can be specified by any particular section or sequence in DNA is what is called a polypeptide chain. A polypeptide chain is a chain of amino acids that corresponds to all of the amino acids used by a particular protein molecule. 

The relationship between amino acids, polypeptide chains, and protein molecules is illustrated by the diagram below:

protein folding not explained

The human body uses more than 20,000 different types of protein molecules, each of which has a particular 3D shape.  Does a mere sequence of amino acids guarantee that some particular 3D shape will arise once that sequence exists? There is no good evidence that such a thing is true. There is a dogma in biology called Anfinsen's Dogma, claiming that the three-dimensional shape of a protein molecule arises automatically once a particular polypeptide sequence exists.  The dogma is not credible, and was never well-established by experiments. Anfinsen did some experiments that he claimed supported such a dogma. But his experiments never really established any such dogma, and his experiments have failed to replicate. See my two posts here for why Anfinsen's Dogma is not well-established, and also not believable. 

What is crystal-clear is that DNA does not specify anything bigger than a polypeptide sequence or a protein molecule. But human bodies have a vast hierarchical organization involving many different levels of organization, and a protein molecule is near the bottom of such a hierarchy.  It works like this: amino acids are organized into polypeptide chains, which are organized into protein molecules, which are organized into protein complexes, which are organized into organelles, which are organized into cells, which are organized into tissues, which are organized into organ systems, which (along with the skeletal system) are the main parts of the human body.  DNA only specifies the lowest levels of such organization. 

DNA does not specify how to make a protein complex (a specific arrangement of proteins serving a functional purpose). DNA does not specify how to make the organelles that are the building components of cells. DNA does not specify how to make cells. DNA does not  specify how to make tissue.  DNA does not how to specify how to make organs. DNA does not specify how to specify how to make organ systems. DNA contains no anatomy information at all. Read my post here for a list of quotes by dozens of scientists or medical authorities who confess that DNA is no blueprint, recipe or program for making a human body. 

The diagram below specifies levels of organization in the human body, and which levels are not specified by DNA:

levels of organization in human body

Among the layers of organization depicted above is the layer of protein complexes, which involves endless examples of particular types of protein molecules magically forming into accidentally unachievable arrangements so complex they are widely called "molecular machines" in mainstream biology literature. One example is shown below, a microscopic device including seven propellers.  

molecular machine
(Image credit:  Wikipedia Commons, derived from Yuan et al. 2010, Structure of an apoptosome-procaspase-9 CARD complex)

Now, let's get back to David Klinghoffer, and his book "Plato's Revenge: The New Science of the Immaterial Genome." Klinghoffer has come to the very important insight that the human genome (human DNA) is not sufficient to specify how to make a human body. But based on all the articles I have read promoting his book, it seems that his argument is based mainly on the quantity of information in DNA. Arguing from the quantity of information in DNA is not the best way to show that DNA (the genome) does not have a specification of how to make a human. By far the best way to show such a thing is by analyzing the content of the information in DNA. A look of the content of the information in DNA (such as I did above) shows that DNA is only low-level chemical information, and that DNA does not specify how to make anything bigger than a protein molecule. Because a human body consists of many layers of organization bigger than a protein molecule, DNA (the genome) cannot specify how to make a human organism or even how to make any cell of an organism. 

But what about the idea of postulating an "immaterial genome" that has such a specification, outside of the human body, as Klinghoffer has done? I think he has had a very important insight, that there must exist some specification or understanding of how to make a human body, one that exists beyond the physical reality of a human body. But I find the use of the term "immaterial genome" to be a very regrettable term. The term "genome" should be limited to what is in DNA or the human body. 

Consider the brain. There are a host of reasons why the human brain is utterly insufficient to explain human mental phenomena such as self-hood, thinking, imagination and memory. Such reasons are explained on my website here. Should we then start talking about an "immaterial brain" to explain how humans get minds? The use of such a term would be very regrettable. It is much better to use terms such as "soul" or "spirit" or "mind."  When talking about the brain, the term "brain" should be restricted to mean only the physical matter in the skull of a person. That way you can very clearly talk about what is and is not in the brain. 

Just as it is clumsy and inappropriate to use the term "immaterial brain" when talking about the need to specify a human soul or spirit, it is inappropriate to use the term "immaterial genome" to refer to some postulated non-material specification or understanding of how to make a human body. Such a thing is not a genome, and should not be called a genome. 

I have one other objection to the summaries I have read of  Klinghoffer's book. Such summaries seem to suggest that if there existed some immaterial or transcendent specification of how to make a human, that such a thing might explain how human bodies arise. I don't think that is correct. You could only explain the origin of a human body by postulating some type of agency that acted while using such a specification. Specifications do not build very complex things. 

Consider a blueprint. If you merely dump some construction materials such as bricks, pipes, wire, floorboards and 2" by 4" wood beams at an empty construction lot, and also dump a blueprint next to such materials, that will not cause a house to be built. Blueprints do not build things. Things only get built with the help of blueprints when there is at least one intelligent agent to read blueprints, and get ideas about how to build things. 

So imagine there was some immaterial specification for how to make a human body. That would not explain the construction of a human body. Low-level components such as protein molecules and organelles and cells would not be able to read such an enormously complex specification on how to build a body, and would not be able to get ideas from such a specification on how they should act to help achieve the construction of a human body. 

Plato was the greatest writer of all the philosophers, and his Dialogues are some of the greatest masterpieces of philosophy.  I've read every one of them. The philosophical idea that Plato kept advancing is that individual material instances are instantiations of a transcendent form or schema of some particular type. So according to such an idea, a material house is an instantiation of a transcendent Idea of a House or an immaterial Form of a House; and a material human is an instantiation of a transcendent Idea of a Human or an immaterial Form of a Human. A wikipedia.org article tells us this:

"According to this theory, Forms—conventionally capitalized and also commonly translated as Ideas—are the timeless, absolute, non-physical, and unchangeable essences of all things, which objects and matter in the physical world merely participate in, imitate, or resemble. In other words, Forms are various abstract ideals that exist even outside of human minds and that constitute the basis of reality."

But we cannot explain the origin of a human body by merely imagining that there is some transcendent schema of a human that somehow gets instantiated. That would not explain how a billion diverse details of organization get accomplished, and how endless millions of feats of precise biochemistry engineering get done. 

miracle of morphogenesis

 To have a credible hypothesis of the origin of dynamic physical states of vast organization such as the human body,  we must assume a purposeful top-down organizational effect. Given a lack of anything in a human body that explains the full reproduction of a human (not to be confused with mere pregnancy), it is utterly insufficient to assume that such a purposeful organizational effect merely acted in the past. We should assume that such a purposeful organizational effect acts continuously throughout all of our lives, and acts across all parts of the planet in which large superbly organized organisms exist.  A good acronym to describe such a reality is the acronym GOAL, which stands for Global Organizing Activity of a Life-Force. Such an acronym is suitable, given the dramatically teleological and purposefulness of such an agency. 

To read about the case for believing in such a reality, read my post "GOAL and Soul: Postulating What We Need to Explain Humans." 

Throughout our lives many science professors have been attempting to brainwash us into believing the groundless doctrine that laws of physics and chemistry can explain everything in some mechanistic way.  Nature never provided any warrant for such claims. The laws of physics and chemistry that can explain some lifeless and mindless phenomena such as gravity, lightning and freezing utterly fail when it comes to explaining the mind-boggling wonders of physical biological organization and the wonders of human minds, human mental capabilities and human mental experiences.  There is a huge body of functional information in DNA, consisting mainly of specifications for which amino acids make up particular proteins.  But physics and chemistry do not explain the origin of such information, which also is not credibly explained by any ideas of so-called natural selection or evolution (for reasons I discuss here and here).  And that  huge body of functional information in DNA is not even a hundredth of the information needed to have a specification of how to make a living human body.  Once a full human body arises, you do not have an explanation for human minds and human memory, which are not credibly explained by brains, for reasons discussed at very great length at my site here. Evolution does not explain DNA; DNA does not explain bodies; and bodies do not explain minds. 

Plato had no understanding of the vast hierarchical organization and enormously fine-tuned functional complexity of the human body, and its endless cases of component interdependence. What we need to postulate to credibly explain the arising of such organization and functional complexity during the nine months of pregnancy is a mind-boggling reality beyond anything Plato conceived. 

Even though he seems to be using some poorly chosen terminology,  Klinghoffer seems to merit praise for coming to the extremely important realization that human bodies do not contain any specification for how to build human bodies. Anyone who comes to that realization has made some very important progress, and has discovered one of what I call the Seven Main Clues About Reality (I suspect Klinghoffer has discovered several of these). For a discussion of these clues and their implications, read my post here. 

7 Main Clues About Reality

Although not the best reason for rejecting claims that DNA is a specification for making  a human,  the reason involving the insufficient size of the human genome is still one of numerous reasons for rejecting such a claim. In my 2016 post "The Gigantic Missing Link of Biological Life," I explained six reasons for rejecting the claim that DNA is a specification for building a human body. The six reasons I listed were these:

Reason #1: The “language” used by DNA is a minimal feature-poor language lacking any grammar or capability for expressing anything like a blueprint, a recipe, a program or an algorithm for making a human being.

Reason #2: Even if the “language” used by DNA had the capability of expressing a blueprint or recipe or program for making a human, there would be nothing that we know of capable of interpreting such instructions.

Reason #3: Despite cataloging the entire human genome, and exhaustively analyzing it, scientists have not discovered any part of DNA where a blueprint of the human body or a recipe for making humans is stored.

Reason #4: If DNA stored a human blueprint or human recipe or body plan, humans would have a much larger DNA than simpler organisms; instead, the opposite is often true.

Reason #5: The DNA size of humans is insufficient to be a blueprint or recipe for the human body with all its complexities.

Reason #6: If DNA stored a recipe or blueprint for making humans, we would probably sometimes see extremely jumbled bodies resulting from mutations, but we don't see such “scrambled humans.”

I think these reasons have stood up extremely well over the nine years since I wrote that post, and I see no reason to modify any of them. Reason #5 was a claim that the human genome is not big enough to be a specification for making a human, a reason similar to the main reason Klinghoffer now gives for disbelieving that the genome can specify how to make a human. I regarded that Reason #5 as being less weighty that the first three reasons I gave.  Here is what I said to back up that Reason #5 back in 2016:

"Astonishingly our biologists have sometimes assumed that DNA is a complete specification for constructing a human body, but I have never once read a biologist consider whether the information size of DNA is sufficient for such a task. The idea that DNA can store a complete specification for a human being will obviously make no sense if our DNA molecules are not big enough to store such a specification, just as it will make no sense to assume that a postcard can store the names of all members of a club if the club has many thousands of members.

It has been estimated that a DNA molecule has an information size of about 700 megabytes. This is not big enough to store a complete blueprint, algorithm, or program for creating a human being. If you use the uncompressed RAW files used in cameras, it will take about 8 megabytes to store a high resolution photo. This means human DNA has an information size needed to store about 100 high-resolution photos uncompressed. This is not big enough to store a complete specification for making the human body. A recently introduced CT scanner requires 320 scans to map a human body, each scan equivalent to such an 8 megabyte photo. But consider also all the microscopic functionality that would need to be specified, and all of the microscopic details. It would seem that it would require many gigabytes to store a complete plan for building a human, not just 700 megabytes." 

Here is a very rough calculation you can make to show how ridiculously inadequate is 700 megabytes (the size of the human genome) to store all of the information needed to make a human body. It has been estimated that the human body has about 37 trillion cells. Now, let us completely ignore the vast amount of information required to specify the structure of such cells, and merely consider how much information is needed to specify the exact positions of each of them in the body. Humans have about 200 types of cells, and cells must be very precisely positioned. The right type of cell needs to be in the right position for the human body to work correctly.  

Now to specify the mere position and cell type of any particular cell in the human body you would need at least four bytes per cell. Using a three-dimensional grid that was roughly 500 millimeters by 500 millimeters by 1000 millimeters, you would need at least four bytes per cell to specify a cell type and the three-dimensional position of each cell (assuming some very convenient notation system allowing you to specify a cell type by merely giving a number between 1 and 200). What would be the storage requirements needed to merely specify the positions and cell types for 37 trillion cells? It would be roughly 100 trillion bytes. But that would be a size roughly 100,000 times greater than the known size of the human genome. 

In reality, the human genome (DNA) contains not a single particle of any such information. Nowhere in DNA is there any system allowing the specification of the three-dimensional position of anything. Nowhere in DNA is there any such thing as a specification of how to make a cell or any of the organelles that make up a cell. Nowhere in DNA is there any such thing as a notation system by which a cell type can be specified. 

Wednesday, May 28, 2025

Scientist Flubs and Flops, #5



neuroscience failure


Darwinism failure

neuroscience failure


scientist boasting

evidence ignoring neuroscientist

misleading scientist boast

evolution of materialism

deterioration of science

scientist selling pills



fake physics

scientist filter bubble


                Press button to watch video

boastful scientist legends


sinking materialist paradigm




  • "The origins of major morphological novelties remain unsolved...No one has satisfactorily demonstrated a mechanism at the population genetic level by which innumerable very small phenotypic changes could accumulate rapidly to produce large changes: a process for the origin of the magnificently improbable from the ineffably trivial." Keith Stewart Thomson,  "Macroevolution: The Morphological Problem"
  • "Selection based on survival of the fittest is insufficient for other than microevolution. Realistic probability calculations based on probabilities associated with microevolution are presented. However, macroevolution (required for all speciation events and the complexifications appearing in the Cambrian explosion) are shown to be probabilistically highly implausible (on the order of 10−50) when based on selection by survival of the fittest. We conclude that macroevolution via survival of the fittest is not salvageable by arguments for random genetic drift and other proposed mechanisms...Evolution of a few flowers on a hillside is reasonably explained by mutation and selection; it stretches logic to explain the millions of extremely diverse species seen currently and in the fossil record...Microevolution is probabilistically realistic; macroevolution is not, and this is documented empirically."  -- Olen R. Brown and David A. Hullender, "Neo-Darwinism must Mutate to survive," 2022, (link). 
  • "Darwinism is not a testable scientific theory, but a metaphysical research programme."  -- Philosopher of science Karl Popper (link). 
  • "In discussions with biologists I met large difficulties when they apply the concept of ‘natural selection’ in a rather wide field, without being able to estimate the probability of the occurrence in a empirically given time of just those events, which have been important for the biological evolution. Treating the empirical time scale of the evolution theoretically as infinity they have then an easy game, apparently to avoid the concept of purposesiveness. While they pretend to stay in this way completely ‘scientific’ and ‘rational’, they become actually very irrational, particularly because they use the word ‘chance’, not any longer combined with estimations of a mathematically defined probability, in its application to very rare single events more or less synonymous with the old word ‘miracle’.” -- Eminent physicist Wolfgang von Pauli, discoverer of the biologically crucial Pauli Exclusion Principle (link).
  • “Nowhere in the world has any recognizable trace been found of an animal that would close the considerable structural gap between Hyracotherium and the most likely ancestral order, the Condylarthra. This is true for all of the thirty-two orders of mammals, and in most cases the break in the record is still more striking....The earliest and most primitive known members of every order already have the most basic ordinal characters and in no case is an approximately continuous sequence from one order to another known. In most cases the break is so sharp and the gap so large that the origin of the order is speculative and much disputed." -- George Gaylord Simpson (a leading paleontologist), "Tempo and Mode in Evolution," page 106.
  • "The absence of fossil evidence for intermediary stages between major transitions in organic design, indeed our inability, even in our imagination, to construct functional intermediates in many cases, has been a persistent and nagging problem for gradualistic accounts of evolution." -- Stephen Jay Gould, a leading paleontologist, "Evolution Now: A Century After Darwin," page 140, 1983. 
  • "The published hominin fossil record does not yet have a true intermediate stage between an apelike and a humanlike body." -- Anthropology professor Henry M. McHenry, "Evolution: The First Four Billion Years," page 270. 
  • "I have recently come to realize that the assumed evidence for common descent becomes much less convincing the closer you look into the details....According to the most recent and most comprehensive studies, the previous decades of phylogenetic trees, evolutionary scenarios, and reconstructed ancestors (ground plans) would all be utterly incorrect....Evolutionary biology is a state of disarray. Something is clearly and profoundly off the mark and conflicting with any expectations from Darwinian theory. I can only urge my colleagues to stop closing their eyes, only because of world view blinders, and recognize the obvious need for a paradigm change, because we have just scratched the surface of the problems." -- Paleontologist Günter Bechly (link). 
  • "The study of human prehistory attracts the most ambitious and, as one member of the discipline put it to me, 'the most psychotic', palaeontologists.... Our direct knowledge of the first few million years of human evolution derives from a collection of bone fragments that could no more than halfway fill a large shoebox....Attempting to reconstruct the history of early humanity from the available evidence is, it has been said, akin to trying to divine the plot of War and Peace from just 13 of its pages, picked at random."  -- Year 2025 article in The Guardian, a materialist-leaning newspaper (link).

Sunday, May 25, 2025

40 Years Into a Science-Related Career, Many Show Little Progress in Their Thinking or Methods

I have noticed that many scientists and science journalists plod on for thirty or forty or fifty years while showing almost no signs of progress in their thinking or methods. For example:

  • There's a nearing-retirement-age cosmologist I know of who has been grinding out the same type of work for 40 years, endlessly peddling the same theories that have never been backed up by direct observations during such a period. I get a feeling that he has not learned any lessons from his 40 years in the field, and that he completely failed to learn a lesson of "don't be so dogmatically enthusiastic about things that no one ever observed." 
  • There's a science journalist who for decades has been the main writer of science-related stories at a major newspaper. During that time his work has been guilty of very bad "hook, line and sinker" credulity when it comes to reporting on unfounded claims of scientists. I see no sign of any improvement in his writings, which seem to be still making newbie science journalist mistakes. 
  • There's a guy whose career has been centered upon the search for extraterrestrial intelligence. He has not got anywhere in such searches, and neither has any of his colleagues. But he seems to have learned no lesson from such a failure. 
  • There are the science specialists who have spent 40 years in some very narrow field of inquiry, like someone looking at reality through a straw hole. Many of them acted as if their goal was to get as many papers published as they could, rather than to do the kind of broad studies needed for insight about reality. Instead of studying the most fundamental issues relevant to gaining insight about reality, they spent their careers focusing on some tiny fragment of the big picture, like some person working on a jigsaw puzzle who neglects to put together the pieces, and spends all his time focusing on only one puzzle piece. 
  • There's a biologist in his eighties who has shown zero real progress in moving towards credible explanations of biological phenomena over the past 50 years of his career.  His latest essay involved mainly dumb evocations of the groundless explanation legends  biologists have been chanting throughout his career, along with a little philosopher name-dropping to make things sound a little more intelligent to those who are impressed by such name-dropping. 
  • There's a physicist-turned-biologist who showed promising signs that he can pay attention to important clues about 45 years ago, but who has proven to be a disappointment since then, doing little but spouting the same easily discredited ideas, which he combines with some clever lure phrases to lure in book readers opposed to such ideas, who are disappointed once they buy his books. 
  • There are many neuroscientists who have had careers spanning 30 or 40 years, but who have shown no improvements in terms of adopting better and more reliable experimental methods. Thirty or forty years ago they were doing junk science studies using way-too-small sample sizes for any reliable result to be credibly claimed. Thirty or forty years later they are still doing the same type of crappy junk research, using the same type of way-too-small sample sizes. Thirty or forty years ago they were using bad, unreliable measurement techniques such as trying to measure fear or recall in mice by doing "freezing behavior" judgments.  Thirty or forty years ago they are still using the same utterly unreliable method.   During those 30 or 40 years all attempts to use microscopes to find evidence of a brain storage of memory have utterly failed. But such neuroscientists have learned nothing from such a failure. 
scientists marching wrong way

This year some person with a science-related career published an article announcing that it will tell us what the person learned over the past 40 years.   The article is a strange piece. An article with such a title would be a great opportunity to discuss the most important insights about reality someone has gained by reading about or reporting on or doing research on scientific topics.  But we seem to not get any such overview from the author.

Instead he uses his article to mainly denounce people who deviate from the scientific mainstream. He seems angry that people are not always believing like they were told to believe by professors. Surely the old timer has learned some important things over these 40 years, but he has done a very poor job of discussing what it was he learned.

Shortly thereafter the same author wrote an extremely misleading article that rather seems to inadvertently tell us what he did not learn in his 40 years in a science-related field.  Among the article's defects are these:

(1) The article propagates the very bad misconception that life is something that might arise once some mere "ingredients" were delivered. Even the simplest one-celled life is a state of enormous organization, requiring the existence of hundreds of different types of protein molecules, each its own separate complex invention requiring a very special arrangement of thousands of atoms. To suggest that a living thing can originate from non-life by a mere depositing of ingredients is as misleading as claiming that a ten-story apartment building can arise by a mere depositing of building materials at a construction site. 

(2) The article makes the untrue claim that high levels of chemicals crucial for life were retrieved by US robot space probe OSIRIS-REx, when it got a soil sample from the asteroid Bennu. Those who analyzed the sample from the asteroid Bennu merely found negligible trace amounts of such chemicals.  The amounts reported were levels such as 70 nanomoles per gram, which is less than 1 part in 100 million. In fact, the levels reported were so low that we can have no confidence that the reported chemicals actually came from the asteroid Bennu. It is well known that trace amounts so tiny can easily be produced by earthly contamination. The issue is discussed in my post here. The fact is that a paper stated that the OSIRIS-REx spacecraft would maintain a cleanliness standard of " <180 ng/cm2 of amino acids" (nanograms per cubic centimeter), but the amino acid abundances reportedly found in the Bennu sample were less than this amount, not greater -- meaning that we can have no confidence that the reported negligible trace amounts came from the asteroid rather than earthly contamination. 

bragging scientists


(3) The article quotes a scientist suggesting the groundless idea that asteroids similar to Bennu crashed on to Earth, bringing crucial ingredients that led to the appearance of life here, a claim that is groundless because of the negligible levels of amino acids found in the Bennu sample, the impossibility of knowing whether such levels are merely due to earthly contamination, and the nonsensical nature of the idea that vastly organized states of matter such as a living thing can appear because of mere depositing of trace ingredients. The author's article lets the goofy claim go unchallenged. 

(4) Later in the article the author makes the groundless claim that observations of the exoplanet K2-18b revealed the chemical dimethyl sulfide, and the untrue claim that the chemical is only produced by life. No such thing occurred, and the study mentioned provided no decent evidence that the compound even exists at K2-18b. You can read about the unwarranted claim and how other scientists have undermined it or denounced it by reading my post here. It is also untrue that the dimethyl sulfide mentioned is only produced by life. My post here cites two scientific papers discussing how such chemicals can be produced when there is no life. 

From the article I can make a list of some of the things that the old-timer with a science-related career spanning 40 years has apparently not learned in the past 40 years. 

(1) He apparently did not learn to supply his readers with the most important relevant facts when reporting on important issues such as whether a soil sample from an asteroid tells us anything important about the origin of life. The most important facts he should have mentioned were facts relating to the enormously high organization level and information richness of even the simplest life, the fact that the reported abundances of life-relevant chemicals were mere negligible trace amounts, and the fact that earthly contamination occurs so frequently in projects such as this that all reports of finding chemicals in such very low trace amounts are reports leaving it unclear as to whether the chemicals even came from outer space.  None of these facts was mentioned in the old timer's article. 

(2) He apparently did not learn to use precise and accurate language when such language is needed, seeing that he referred to high levels of complex chemicals when he should have referred to "extremely tiny trace amounts" or "negligible trace amounts" when referring to those chemicals, and also given that he incorrectly claimed that two chemicals can only be produced by life. 

(3) He apparently did not  learn to avoid misleading metaphorical language or misleading simplistic language, as he has suggested the untrue idea that the origin of life can occur through a mere depositing of ingredients or the mere appearance of simple "building blocks," rather than discussing how the origin of life requires the appearance of many types of extremely organized and specially arranged components (different types of protein molecules). 

(4) He apparently did not learn to apply critical scrutiny to the statements of scientists telling goofy tall tales about never-observed things claimed to have happened long ago, or statements of glory-hounding scientists making very dubious claims to have done grand things they did not actually do. 

All too often people with long science-related careers show way too little sign of having learned important insights and lessons from decades of reading, writing about or producing scientific material.  All too often you may look at 65-year-old Professor Smith, compare him to 30-year-old Professor Smith, and then shake your head in dismay, asking: where was the gain in insight, where are the lessons learned, and where is the improvement in methods? 

When a child goes to First Grade, it can be a year of amazing progress. Here is part of what a typical First Grade report card might look like:

---------------------------------------

PS 124 Report Card

Student Name: Mary Smith

Grade: First Grade

Teacher Comments: Mary has made the most amazing progress during the past nine months! She can now read her entire "Dick and Jane" basic readers with each have 20 illustrated pages. And Mary has also learned how to write! She can write full grammatical sentences such as "This is a nice day and I am good." She often makes spelling errors, but her spelling is improving.

---------------------------------------

What if scientists were to get report cards grading their progress over a 40-year career? Sadly very many of them would need to get report cards like this:

-----------------------------------------

Scientist Progress Report

Scientist Name:  William Stubbornsky

Time Span: 40 Years (1985 - 2025)

Analyst Comments: Regrettably there has been very little progress in the speech and methods of this scientist. He keeps on repeating the same vacuous catchphrases and empty sound bites he would mutter soon after getting his PhD forty years ago: empty phrases such as "synapse strengthening" and groundless claims of "neural representations" and "brain regions lighting up." While he has learned some hi-tech skills such as how to operate fancier equipment, there has been no improvement in the quality of his experimental practices. Forty years ago he was doing low-quality poorly-designed mouse studies using way-too-small sample sizes. He is still doing the same kind of low-quality poorly-reproducible research. He seems to read the writings of only those who think like him. Always making dogmatic claims about the limits of minds and what brains do, he still shows no signs of having seriously studied the very large body of observations that challenge or defy  such claims. 

-----------------------------------------

scientist ideological baggage

Yeah, right

Thursday, May 22, 2025

The Sun Seers of Planet Evercloudy: A Science Fiction Story

In a solar system of the Andromeda galaxy, there was a planet Evercloudy where intelligent life existed. But the planet was very different from Earth. The planet was constantly covered with thick clouds. The clouds in the planet's atmosphere were so numerous that almost never could the planet's sun be seen. 

The scientists on this planet pondered two great questions:

(1) What causes daylight on planet Evercloudy?

(2) How is it that planet Evercloudy stays warm enough for life to exist?

Having no knowledge of their sun, the scientists came up with wrong answers. They speculated that daylight and planetary warmth are bottom-up effects.  The scientists began to spin all kinds of speculations such as hypothesizing that daylight comes from photon emissions from rocks and dirt, and that their planet was warm because of heat bubbling up from the hot center of their planet.

One day one of the scientists had a dinner with his son, who had not long ago become an adult. 

"We are making great progress in explaining how our planet is warm and lighted," said the father, boasting without warrant. "Only last week one of my colleagues published a paper speculating how there might be certain types of chemical reactions within rocks and soil, causing the emission of tiny  particles of light that might lead to daylight, particles we call photons." 

"Ah yes, another theory of photon-emitting rocks and light coming from soil," said the son. "How creative you professors are.  But, tell me, how do you account for the reality of nightfall? If rocks and soil constantly sent out little particles of light called photons, would we not expect that there would never be nightfall?"

"I admit that the phenomenon of nightfall is challenging for bottom-up theories of the origin of our planet's light and heat," conceded the father. "But we are working on that problem. Someday we will solve it. We already have interesting theories of how there might be 'easily tired photons' that rest during the night, and wake up during the daytime."

"Can't you see that there's a much more straightforward way to explain nightfall?" said the son. "You can abandon your theory of a bottom-up origin of light and heat. You can move to an alternate theory that light and heat on our planet mainly comes from an unseen external source outside of our planet -- something called 'the sun.' If such a sun existed, and our planet rotates, that would easily explain nightfall. Nightfall would simply occur to a side of our planet that was facing away from the sun."

"Oh, come on!" said the father. "Don't tell me you are warming up to those nonsense claims about the existence of a sun! You are just starting to study at the university. You know what the consensus of the professors is. It is that heat and light come bottom-up, not top-down. Read your science books. They all say that daylight comes from rocks and soil."

"Yes, I know the social conventions that professors like you follow," said the son. "You and your colleagues have made it taboo to believe in the sun. But does it make sense to declare something is taboo, when it has often been observed?"

"What are you talking about?" asked the father. 

"Have you not heard?" said the son. "There are now meetings of believers in the existence of the sun. They meet outdoors in meetings they call 'see-ances.'  At such meetings they look up at the sky. They gather together in a circle, with each person looking at a different direction. Sometimes the people at such meetings report they were able to see the sun in the sky, when the clouds briefly parted." 

"Don't believe in that kind of nonsense!" said the father. "You can't trust those so-called 'sun-seers.' They are just a bunch a kooks and crazies or scoundrels who are lying or hallucinating." 

"Have you studied the many reports they have written, in which multiple named witnesses said they saw the sun?" asked the son. 

"You mean the reports made in those 'sun-seer' periodicals?" asked the father. "Surely you don't expect a respectable scientist like me to read such rags."

"So when teaching your classes and writing, you don't even mention that many claim to have seen the sun?"

"Of course," said the father. "A rule of respectable professors like me is: nothing spooky allowed." 

"But what about those photos they sometimes take that seem to show a sun in the sky?" asked the son. 

"Oh, come on, don't tell me that you're starting to believe in those claims of 'sun photography,' " said the father. "All those photos are just fakes." 

"Father, this is very hard to do, but I think it is at last time that I finally 'came out of the closet,' " said the son. "I must confess that I have gone to some of these 'see-ances' and that I believe I have actually seen the sun with my own eyes. I had to stare up at the sky for a long time, before the clouds finally started to part. And then I kind of half-saw it, for a fleeing instant, what looked rather like a bright yellow ball in the sky. I think it was the sun I saw." 

"Good heavens!" said the father, grimacing and putting his hands on top of his head. "Don't tell me that my own son has become one of those loony types that call themselves 'sun-seers!'  How will I live through the embarrassment and the stigma of being the father of a 'sun-seer' ? My colleagues at the university will ridicule me endlessly!"  

"Sorry for the inconvenience," said the son. "But I have to follow the path plowed by what I saw, not some old path plowed by social conventions." 

The son went outdoors for some fresh air, and the father followed. 

"Don't you understand our rules?" said the father. "A rule of scientists like me is: explanations must always be bottom-up, not top-down. And you can only say that a causal effect came from some cause you have seen yourself." 

"Nature never taught us such rules," said the son. "Those rules are just social conventions, not something demanded by logic or evidence. And you don't even follow such rules, because you never saw some of the things you believe in, things like photons sleeping at night." 

"I didn't make your mistake when I was young," said the father. "When I started at the university, they taught me that our planet's light and heat come from the rocks and soil below us, not from any sun above us; and I have never taught otherwise."

"But did you arrive at that belief through an objective study of all the evidence, by pondering impartially all the relevant arguments and observations of both sides?" asked the son. "I doubt it. You probably soon learned that a particular belief would be expected of you. So you went along with that belief, and became an asolarist, a non-believer in the sun." 

"Well," said the father, "it was made pretty clear that my university was not a friendly port for solarists who believe in a sun." 

The son looked up at the sky, and was surprised to see a very rare event, as rare on his planet as a tornado. The clouds were briefly parting. It was a much more dramatic parting of the clouds than the son had seen before. 

"Look!" said the son. "The clouds are parting! There it is, I can see it in that hole in the clouds!  Look, father, look! It is a bright and yellow ball! IT IS THE SUN!"

"A respectable professor like me cannot ever get involved with this type of nonsense," said the scorning father, being careful not to look up at the sky. "I'm going back inside our house."