A Recent Paper Indicates a 14% Difference Between the Genomes of Humans and Chimps

The intellectual empire of Darwinism was not built on honest speech.  Darwinism got launched by the word trick of using the phrase "natural selection" for a claimed survival-of-the-fittest effect that was not actually any such thing as selection. "Selection" is a word meaning a choice by a conscious agent, but the so-called natural selection depicted by Darwin was no such thing, being a mere blind accidental process rather than any willful act of selection.  Darwin was also guilty of larger deceits, such as the glaring deceit (in a passage of The Descent of Man) of claiming that " there is no fundamental difference between man and the higher mammals in their mental faculties."  This appalling lie continues to be repeated by the disciples of Darwin, and a few days before writing this post I saw the same witless claim repeated by one of the evangelists of Darwinism, who cited Darwin as his "proof" for this obviously false claim. 

A very silly thing to say

Following in the footsteps of their adored master, the apostles of Darwinism have for a very long time been guilty of dozens of deceits and misrepresentations large and small. In my post here I have a numbered list of 80+ such deceits, word tricks, misleading statements and tall tales.  One of the worst of these deceits has been the massive repetition by Darwinists of a claim that human genomes and chimp genomes are 98% or 98.6% the same. Typically the claim is made without any citation of its source. The word "genome" refers to what is in DNA. The genome includes the set of all genes in the DNA of an organism. 

Below are some of the leading scientific sources where this false claim has been made:

• “We share more than 98 percent of our DNA and almost all of our genes with our closest living relative, the chimpanzee.” (Nature)
• “Most studies indicate that when genomic regions are compared between chimpanzees and humans, they share about 98.5 percent sequence identity.” (Scientific American)
• “Humans and chimps share a surprising 98.8 percent of their DNA.” (American Museum of Natural History)
• “Humans share about 99 percent of our DNA with chimpanzees, making them our closest living relatives.” (Science)

There are many scientific papers contradicting such a claim. A 2005 paper had the title "Eighty percent of proteins are different between humans and chimpanzees."  A 2021 study found that "1.5% to 7% of the human genome is unique to Homo sapiens," suggesting the claim of 98% similarity was in error. The 2021 study "An ancestral recombination graph of human, Neanderthal, and Denisovan genomes" published in the journal Science states, "We find that only 1.5 to 7% of the modern human genome is uniquely human," and later states, "We find that approximately 7% of the human autosomal genome is human-unique and free of both admixture and ILS."  A 2002 paper is entitled "Divergence between samples of chimpanzee and human DNA sequences is 5%, counting indels." 

Recently we had the publication of another paper showing how false is the claim that human DNA is 98% the same as chimpanzee DNA. The paper is one entitled "Complete sequencing of ape genomes," which you can read here. The authors act just as if they were trying to make it almost as hard as possible for readers to get a clear statement of how they debunked the claim that human DNA is 98% similar to chimpanzee DNA. The main body of the text says little more than this on this topic:

"Overall, sequence comparisons among the complete ape genomes revealed greater divergence than previously estimated (Supplementary Notes III–IV). Indeed, 12.5–27.3% of an ape genome failed to align or was inconsistent with a simple one-to-one alignment, thereby introducing gaps."

To get a graph that shows a comparison between the human genome and the chimpanzee genome, you must go to the trouble of opening up the paper's Supplementary Information, as a PDF file. You can do that by using the link here. The average reader will still by stymied, as nowhere in that file do we have a simple quote clearly stating a degree of difference between chimpanzee DNA and human DNA.

Finding the relevant figure requires the following pieces of luck that 99% would not be likely to experience:

• First, you have to know that the Latin name for the chimpanzee species is Pan troglodytes. 
• Then you have to notice that in Supplementary Table VIII.37 the authors are using "mPanTro3" as a tag for the chimpanzee genome. 
• Then you have to somehow find out that the authors are using "hg002" as a tag meaning the human genome. 
• Then you have to somehow find your way to Supplementary Figure III.12, where the seventh row and the eighth row has a comparison between "PanTro3" (the chimpanzee genome) and ""hg002" (the human genome). 

Finally, if all this luck occurs to you, you can get to the relevant visual depiction, which is found in the red rounded rectangle below, where we see a depiction (according to one measure) of the difference between the human genome ("hg002") and the chimpanzee genome ("PanTro3"):

Notice the numbers above. They are about 13%. What the authors have found is that by one important measure (a "gap divergence" measure), there is about a 13% difference between the human genome and the chimpanzee genome. 

Casey Luskin in his post here helped to clarify what is meant by this "gap divergence" measure and another measure called SNV (single-nucleotide variant). He gives us a hypothetical stretch of DNA showing examples of such "gap divergences" and SNV differences:

In the diagram one line represents part of human DNA, and the other line represents part of chimpanzee DNA. The blue parts are parts where you cannot compare the human DNA part to the corresponding part of chimpanzee DNA, or vice versa. 

To compute the total difference between the human genome and the genome of the chimp, we must add these two different types of differences (corresponding to the blue parts and the yellow parts in the diagram above). The paper says that the SNV differences (single-nucleotide variant differences) between humans and chimpanzees are about 1.5%.  To compute the total difference between the genomes we need to add up the 13% "gap difference" measure stated in the paper and the 1.5% SNV measure. That leaves you with a total difference of about 14.5% between the human genome and the chimpanzee genome. 

So the Darwinist authorities who so often told us that there was merely about a 1.5% difference between the genomes of humans and chimpanzees were very much in error, off by a factor of about 1000%. Previous studies published years ago had already shown the falsehood of the the claim of a 1.5% difference between the genomes of humans and chimpanzees, suggesting that that the actual difference was several times larger. But Darwinism evangelists kept citing that phony figure of a 1.5% difference, a figure that was never well-established. 

It is rather obvious why we were so long deceived in this matter. Darwinists have always tried to make the ocean-sized gap between humans and chimpanzees and other apes look like a small gap, as a way of trying to make more credible claims of a natural evolution from an ape-like predecessor to humans. 

A recent article from the very mainstream site LiveScience.com helps clarify that the difference between the genomes of humans and chimpanzees is much greater than 1 or 2 percent. The article tells us this:

"The truth is that the frequently cited 98.8% similarity between chimp (Pan troglodytes) and human (Homo sapiens) DNA overlooks key differences in the species' genomes, experts told Live Science....the 99% figure is misleading because it focuses on stretches of DNA where the human and chimp genomes can be directly aligned and ignores sections of the genomes that are difficult to compare, Tomas Marques-Bonet, head of the Comparative Genomics group at the Institute of Evolutionary Biology (CSIC/UPF) in Barcelona, Spain, told Live Science in an email.

Sections of human DNA without a clear counterpart in chimp DNA make up approximately 15% to 20% of the genome, Marques-Bonet said. For example, some bits of DNA are present in one species but missing in the other; these are known as 'insertions and deletions'...

So, while earlier studies suggested a 98% to 99% similarity, comparisons that include harder-to-align regions push that difference closer to 5% to 10%, Marques-Bonet said. 'And if we account for the regions still too complex to align properly with current technology, the true overall difference is likely to exceed 10%,'  he said.

In fact, a 2025 study found that human and chimpanzee genomes are approximately 15% different when compared directly and completely." 

What happened is that our mainstream biology authorities for quite a few recent years engaged in the most outrageous deceit by making the false claim that human DNA is 98% the same or 99% the same as chimpanzee DNA. This is only one of innumerable lies and deceits and misleading claims that over the decades have been used to prop up the dubious claims of Darwinists. 

Acting like a giant echo chamber, the ideological soldiers of the materialist mainstream tend to uncritically repeat any useful-sounding sound bite that seems to them like a good talking point. So by a process of social contagion in a herd-like conformist community, an incorrect talking point can become a belief community speech custom, with the same false claim repeated on a thousand web pages and in a thousand professor lectures. 

In the year 2025 the materialist-oriented newspaper The Guardian published an article confessing how scanty is the claimed fossil evidence for the evolution of humans from apelike predecessors. It stated this:

"Our direct knowledge of the first few million years of human evolution derives from a collection of bone fragments that could no more than halfway fill a large shoebox....Attempting to reconstruct the history of early humanity from the available evidence is, it has been said, akin to trying to divine the plot of War and Peace from just 13 of its pages, picked at random."

The wikipedia.org article on "Chimpanzee-human last common ancestor" (CHLCA) confesses, "no fossil has yet been identified as a probable candidate for the CHLCA." Faced with the weakness of fossil evidence backing up the claim that humans and chimpanzees are descendants of a common ancestor, the assertion that human and chimpanzee genomes were 98% or 99% similar seemed to serve as a crucial substitute talking point.  Now that it is clear that such a talking point was untrue, our confidence in such an ancestry claim should be disrupted or shattered. 

Is the recent LiveScience.com article an indication that scientists will no longer give us deceptive miseducation on this topic, and will tell us the truth on this topic from now on? Not quite. The article gives us some evidence of the deceit continuing. The article ends with a quote by a scientist saying, "Humans and chimps are made up of essentially the same building blocks (proteins), but these are used in somewhat different ways to make a human versus a chimp." This sentence misleads us in four ways:

• Organisms such as chimpanzees and humans are not honestly described as being "made up of" proteins. Physically a human is made up of a skeletal system and organ systems, which are made up of organs and other components, which are made up of tissues, which are made up of enormously organized cells, which are made up of organelles, which are made up of protein complexes, which are made up of proteins. You vastly misstate the amount of organization in the human body when you say that humans are made up of proteins. 
• Proteins are way too complex to be honestly described as "building blocks." A building block is something all made of the same thing, usually clay. Protein molecules are very complex components built up of hundreds or thousands of very specially arranged amino acids, with each protein molecule having thousands of well-arranged atomic parts. The continued use of the dishonest phrase "building blocks" to refer to things with thousands of well-arranged parts is an inexcusable deception which can be easily avoided by using the term "building components." 
• It is not true that humans and chimpanzees are made up of the same proteins, because a 2005 paper had the title "Eighty percent of proteins are different between humans and chimpanzees."  
• Given all the physical differences and mental differences between bipedal humans who can speak very well and fast and non-speaking chimps who normally walk on four limbs rather than two, it is misleading to claim that proteins are merely used in "somewhat different ways" in humans. 

We can expect that lies about a mere 1% genomic difference between chimps and humans will long continue, just as many biologists have long continued to tell the even worse lie that there is in DNA or its genes a blueprint, recipe or program for making a human body (a lie told because of reasons explained here). The ideological motivation for telling the first of these lies is basically the same as the ideological motivation for telling the second of these lies. 

Postscript: In the 2018 post here, the biologist Richard Buggs stated this: "The percentage of nucleotides in the human genome that had one-to-one exact matches in the chimpanzee genome was 84.38%." Buggs has a blog sometimes stating contrarian viewpoints regarding biological origins. You can read it here. 

Platonism Is No Fix for the Ocean-Sized Explanatory Shortfalls of Biology

 At the Evolution News web site (www.evolutionnews.org), there are some very good articles, that sometimes appear with other articles that may fail in one way or another.  Examples of its failing articles include its occasional off-topic articles that seem to argue against all forms of medical assistance in dying, articles that sound wrong because those in agony while dying from the most painful types of cancer should have a euthanasia option. Examples of the better offerings at the site were a recent set of articles (here and here and here) by Casey Luskin, which did a great job of clarifying the findings of an important scientific paper. 

There has been a massive repetition by Darwinists of an untrue claim that human genomes and chimp genomes are 98% or 98.6% the same. But a 2005 paper had the title "Eighty percent of proteins are different between humans and chimpanzees."  A 2021 study found that "1.5% to 7% of the human genome is unique to Homo sapiens," suggesting the claim of 98% similarity was probably in error. The study "An ancestral recombination graph of human, Neanderthal, and Denisovan genomes" published in the journal Science states, "We find that only 1.5 to 7% of the modern human genome is uniquely human," and later states, "We find that approximately 7% of the human autosomal genome is human-unique and free of both admixture and ILS."  A 2002 paper is entitled "Divergence between samples of chimpanzee and human DNA sequences is 5%, counting indels."  

The year 2025 paper analyzed by Luskin is "Complete sequencing of ape genomes," which you can read here. It reports in its Supplementary Figure III.12 (row 7 and row 8) that according to one measure, the difference between the human genome and the chimpanzee genome is about 12% or 13%. Luskin's posts  (here and here)  clarify that when we add this difference to another difference reported in the same paper, we are left with a  roughly 14% difference between the human genome and the chimpanzee genome. Our mainstream biology authorities again and again told us an untrue claim that our genomes are 98.6%  the same as that of chimpanzees, a claim that they wanted to believe, but which was wrong by a factor of 10. 

A recent series of articles at the Evolution News site are promoting a book by David Klinghoffer, one entitled "Plato's Revenge: The New Science of the Immaterial Genome." I have not read the book, but from reading several of the articles promoting the book, such as this one and this one, I can get a rough idea of the line of reasoning that Klinghoffer is attempting. The line of reasoning seems to go like this:

(1) Some reasoning is used to present the idea that the human genome (our DNA) does not have anything close to the amount of information needed to specify a human organism.  The reasoning revolves around the claim that you would need something much bigger than DNA to specify how to make a human body. 

(2) Such reasoning is used to launch the idea that there is an "immaterial genome," a specification for how to make a human being, that somehow exists in some transcendent sense, rather like the platonic forms postulated by the ancient philosopher Plato. 

(3) The existence of such a transcendent specification of a human is suggested as some solution to the problem of explaining how a human body arises. 

I think that such reasoning is a "hit and miss" affair that is a mixture of an extremely important insight, and also maybe one or two mistakes. The extremely important insight is that the human genome is very much insufficient to specify how to make a human body. But the approach of trying to establish such a claim mainly by making an argument based on information quantity is a clumsy one. A much better way to establish such a claim is by referring to the content of the genome, not its quantity. 

What is the content of human DNA, the human genome? DNA consists of only very low-level chemical information such as information specifying which amino acids make up a protein. The best way to understand what is in DNA is to study the only coding system that has ever been discovered in DNA, what is called the genetic code. The genetic code is depicted in the diagram below. 

The letters A, C, T and G in the diagram specify different types of nucleotide base pairs found in DNA. A stands for adenine, C stands for cytosine, T stands for thymine, and G stands for guanine. DNA is a long string-like molecule. A particular section of DNA may consist of some combination of these four chemicals. So some tiny fraction of DNA may look like this:

ATCGCATTACGTATGGCATTACGT

And some other tiny fraction of DNA may look like this:

CTGGCATTACGAATGGCATTACGT

Particular triple combinations of such chemicals symbolize particular amino acids, using the system shown in the circle diagram above. So in DNA particular sequences of three of these chemicals may symbolize one of the twenty amino acids shown below, the twenty amino acids used by living things:

 

The 20 amino acids used by human bodies (Credit: Wikipedia Commons)

What is the largest thing that can be specified by a particular sequence of these chemicals (A, C, T and G, or adenine,  cytosine,  thymine, and guanine) in DNA? The largest thing that can be specified by any particular section or sequence in DNA is what is called a polypeptide chain. A polypeptide chain is a chain of amino acids that corresponds to all of the amino acids used by a particular protein molecule. 

The relationship between amino acids, polypeptide chains, and protein molecules is illustrated by the diagram below:

The human body uses more than 20,000 different types of protein molecules, each of which has a particular 3D shape.  Does a mere sequence of amino acids guarantee that some particular 3D shape will arise once that sequence exists? There is no good evidence that such a thing is true. There is a dogma in biology called Anfinsen's Dogma, claiming that the three-dimensional shape of a protein molecule arises automatically once a particular polypeptide sequence exists.  The dogma is not credible, and was never well-established by experiments. Anfinsen did some experiments that he claimed supported such a dogma. But his experiments never really established any such dogma, and his experiments have failed to replicate. See my two posts here for why Anfinsen's Dogma is not well-established, and also not believable. 

What is crystal-clear is that DNA does not specify anything bigger than a polypeptide sequence or a protein molecule. But human bodies have a vast hierarchical organization involving many different levels of organization, and a protein molecule is near the bottom of such a hierarchy.  It works like this: amino acids are organized into polypeptide chains, which are organized into protein molecules, which are organized into protein complexes, which are organized into organelles, which are organized into cells, which are organized into tissues, which are organized into organ systems, which (along with the skeletal system) are the main parts of the human body.  DNA only specifies the lowest levels of such organization. 

DNA does not specify how to make a protein complex (a specific arrangement of proteins serving a functional purpose). DNA does not specify how to make the organelles that are the building components of cells. DNA does not specify how to make cells. DNA does not  specify how to make tissue.  DNA does not how to specify how to make organs. DNA does not specify how to specify how to make organ systems. DNA contains no anatomy information at all. Read my post here for a list of quotes by dozens of scientists or medical authorities who confess that DNA is no blueprint, recipe or program for making a human body. 

The diagram below specifies levels of organization in the human body, and which levels are not specified by DNA:

Among the layers of organization depicted above is the layer of protein complexes, which involves endless examples of particular types of protein molecules magically forming into accidentally unachievable arrangements so complex they are widely called "molecular machines" in mainstream biology literature. One example is shown below, a microscopic device including seven propellers.  

(Image credit:  Wikipedia Commons, derived from Yuan et al. 2010, Structure of an apoptosome-procaspase-9 CARD complex)

Now, let's get back to David Klinghoffer, and his book "Plato's Revenge: The New Science of the Immaterial Genome." Klinghoffer has come to the very important insight that the human genome (human DNA) is not sufficient to specify how to make a human body. But based on all the articles I have read promoting his book, it seems that his argument is based mainly on the quantity of information in DNA. Arguing from the quantity of information in DNA is not the best way to show that DNA (the genome) does not have a specification of how to make a human. By far the best way to show such a thing is by analyzing the content of the information in DNA. A look of the content of the information in DNA (such as I did above) shows that DNA is only low-level chemical information, and that DNA does not specify how to make anything bigger than a protein molecule. Because a human body consists of many layers of organization bigger than a protein molecule, DNA (the genome) cannot specify how to make a human organism or even how to make any cell of an organism. 

But what about the idea of postulating an "immaterial genome" that has such a specification, outside of the human body, as Klinghoffer has done? I think he has had a very important insight, that there must exist some specification or understanding of how to make a human body, one that exists beyond the physical reality of a human body. But I find the use of the term "immaterial genome" to be a very regrettable term. The term "genome" should be limited to what is in DNA or the human body. 

Consider the brain. There are a host of reasons why the human brain is utterly insufficient to explain human mental phenomena such as self-hood, thinking, imagination and memory. Such reasons are explained on my website here. Should we then start talking about an "immaterial brain" to explain how humans get minds? The use of such a term would be very regrettable. It is much better to use terms such as "soul" or "spirit" or "mind."  When talking about the brain, the term "brain" should be restricted to mean only the physical matter in the skull of a person. That way you can very clearly talk about what is and is not in the brain. 

Just as it is clumsy and inappropriate to use the term "immaterial brain" when talking about the need to specify a human soul or spirit, it is inappropriate to use the term "immaterial genome" to refer to some postulated non-material specification or understanding of how to make a human body. Such a thing is not a genome, and should not be called a genome. 

I have one other objection to the summaries I have read of  Klinghoffer's book. Such summaries seem to suggest that if there existed some immaterial or transcendent specification of how to make a human, that such a thing might explain how human bodies arise. I don't think that is correct. You could only explain the origin of a human body by postulating some type of agency that acted while using such a specification. Specifications do not build very complex things. 

Consider a blueprint. If you merely dump some construction materials such as bricks, pipes, wire, floorboards and 2" by 4" wood beams at an empty construction lot, and also dump a blueprint next to such materials, that will not cause a house to be built. Blueprints do not build things. Things only get built with the help of blueprints when there is at least one intelligent agent to read blueprints, and get ideas about how to build things. 

So imagine there was some immaterial specification for how to make a human body. That would not explain the construction of a human body. Low-level components such as protein molecules and organelles and cells would not be able to read such an enormously complex specification on how to build a body, and would not be able to get ideas from such a specification on how they should act to help achieve the construction of a human body. 

Plato was the greatest writer of all the philosophers, and his Dialogues are some of the greatest masterpieces of philosophy.  I've read every one of them. The philosophical idea that Plato kept advancing is that individual material instances are instantiations of a transcendent form or schema of some particular type. So according to such an idea, a material house is an instantiation of a transcendent Idea of a House or an immaterial Form of a House; and a material human is an instantiation of a transcendent Idea of a Human or an immaterial Form of a Human. A wikipedia.org article tells us this:

"According to this theory, Forms—conventionally capitalized and also commonly translated as Ideas—are the timeless, absolute, non-physical, and unchangeable essences of all things, which objects and matter in the physical world merely participate in, imitate, or resemble. In other words, Forms are various abstract ideals that exist even outside of human minds and that constitute the basis of reality."

But we cannot explain the origin of a human body by merely imagining that there is some transcendent schema of a human that somehow gets instantiated. That would not explain how a billion diverse details of organization get accomplished, and how endless millions of feats of precise biochemistry engineering get done. 

 To have a credible hypothesis of the origin of dynamic physical states of vast organization such as the human body,  we must assume a purposeful top-down organizational effect. Given a lack of anything in a human body that explains the full reproduction of a human (not to be confused with mere pregnancy), it is utterly insufficient to assume that such a purposeful organizational effect merely acted in the past. We should assume that such a purposeful organizational effect acts continuously throughout all of our lives, and acts across all parts of the planet in which large superbly organized organisms exist.  A good acronym to describe such a reality is the acronym GOAL, which stands for Global Organizing Activity of a Life-Force. Such an acronym is suitable, given the dramatically teleological and purposefulness of such an agency. 

To read about the case for believing in such a reality, read my post "GOAL and Soul: Postulating What We Need to Explain Humans." 

Throughout our lives many science professors have been attempting to brainwash us into believing the groundless doctrine that laws of physics and chemistry can explain everything in some mechanistic way.  Nature never provided any warrant for such claims. The laws of physics and chemistry that can explain some lifeless and mindless phenomena such as gravity, lightning and freezing utterly fail when it comes to explaining the mind-boggling wonders of physical biological organization and the wonders of human minds, human mental capabilities and human mental experiences.  There is a huge body of functional information in DNA, consisting mainly of specifications for which amino acids make up particular proteins.  But physics and chemistry do not explain the origin of such information, which also is not credibly explained by any ideas of so-called natural selection or evolution (for reasons I discuss here and here).  And that  huge body of functional information in DNA is not even a hundredth of the information needed to have a specification of how to make a living human body.  Once a full human body arises, you do not have an explanation for human minds and human memory, which are not credibly explained by brains, for reasons discussed at very great length at my site here. Evolution does not explain DNA; DNA does not explain bodies; and bodies do not explain minds. 

Plato had no understanding of the vast hierarchical organization and enormously fine-tuned functional complexity of the human body, and its endless cases of component interdependence. What we need to postulate to credibly explain the arising of such organization and functional complexity during the nine months of pregnancy is a mind-boggling reality beyond anything Plato conceived. 

Even though he seems to be using some poorly chosen terminology,  Klinghoffer seems to merit praise for coming to the extremely important realization that human bodies do not contain any specification for how to build human bodies. Anyone who comes to that realization has made some very important progress, and has discovered one of what I call the Seven Main Clues About Reality (I suspect Klinghoffer has discovered several of these). For a discussion of these clues and their implications, read my post here. 

Although not the best reason for rejecting claims that DNA is a specification for making  a human,  the reason involving the insufficient size of the human genome is still one of numerous reasons for rejecting such a claim. In my 2016 post "The Gigantic Missing Link of Biological Life," I explained six reasons for rejecting the claim that DNA is a specification for building a human body. The six reasons I listed were these:

Reason #1: The “language” used by DNA is a minimal feature-poor language lacking any grammar or capability for expressing anything like a blueprint, a recipe, a program or an algorithm for making a human being.

Reason #2: Even if the “language” used by DNA had the capability of expressing a blueprint or recipe or program for making a human, there would be nothing that we know of capable of interpreting such instructions.

Reason #3: Despite cataloging the entire human genome, and exhaustively analyzing it, scientists have not discovered any part of DNA where a blueprint of the human body or a recipe for making humans is stored.

Reason #4: If DNA stored a human blueprint or human recipe or body plan, humans would have a much larger DNA than simpler organisms; instead, the opposite is often true.

Reason #5: The DNA size of humans is insufficient to be a blueprint or recipe for the human body with all its complexities.

Reason #6: If DNA stored a recipe or blueprint for making humans, we would probably sometimes see extremely jumbled bodies resulting from mutations, but we don't see such “scrambled humans.”

I think these reasons have stood up extremely well over the nine years since I wrote that post, and I see no reason to modify any of them. Reason #5 was a claim that the human genome is not big enough to be a specification for making a human, a reason similar to the main reason Klinghoffer now gives for disbelieving that the genome can specify how to make a human. I regarded that Reason #5 as being less weighty that the first three reasons I gave.  Here is what I said to back up that Reason #5 back in 2016:

"Astonishingly our biologists have sometimes assumed that DNA is a complete specification for constructing a human body, but I have never once read a biologist consider whether the information size of DNA is sufficient for such a task. The idea that DNA can store a complete specification for a human being will obviously make no sense if our DNA molecules are not big enough to store such a specification, just as it will make no sense to assume that a postcard can store the names of all members of a club if the club has many thousands of members.

It has been estimated that a DNA molecule has an information size of about 700 megabytes. This is not big enough to store a complete blueprint, algorithm, or program for creating a human being. If you use the uncompressed RAW files used in cameras, it will take about 8 megabytes to store a high resolution photo. This means human DNA has an information size needed to store about 100 high-resolution photos uncompressed. This is not big enough to store a complete specification for making the human body. A recently introduced CT scanner requires 320 scans to map a human body, each scan equivalent to such an 8 megabyte photo. But consider also all the microscopic functionality that would need to be specified, and all of the microscopic details. It would seem that it would require many gigabytes to store a complete plan for building a human, not just 700 megabytes." 

Here is a very rough calculation you can make to show how ridiculously inadequate is 700 megabytes (the size of the human genome) to store all of the information needed to make a human body. It has been estimated that the human body has about 37 trillion cells. Now, let us completely ignore the vast amount of information required to specify the structure of such cells, and merely consider how much information is needed to specify the exact positions of each of them in the body. Humans have about 200 types of cells, and cells must be very precisely positioned. The right type of cell needs to be in the right position for the human body to work correctly.  

Now to specify the mere position and cell type of any particular cell in the human body you would need at least four bytes per cell. Using a three-dimensional grid that was roughly 500 millimeters by 500 millimeters by 1000 millimeters, you would need at least four bytes per cell to specify a cell type and the three-dimensional position of each cell (assuming some very convenient notation system allowing you to specify a cell type by merely giving a number between 1 and 200). What would be the storage requirements needed to merely specify the positions and cell types for 37 trillion cells? It would be roughly 100 trillion bytes. But that would be a size roughly 100,000 times greater than the known size of the human genome. 

In reality, the human genome (DNA) contains not a single particle of any such information. Nowhere in DNA is there any system allowing the specification of the three-dimensional position of anything. Nowhere in DNA is there any such thing as a specification of how to make a cell or any of the organelles that make up a cell. Nowhere in DNA is there any such thing as a notation system by which a cell type can be specified. 

The Missing Specifications Problem in Biology

Most biologists have heard of a problem called the missing heritability problem. It is has to do with a huge discrepancy in the degree to which traits are heritable, depending on different methods used to calculate heritability.  Speaking about issues related to this missing heritability problem, this Guardian article quotes a psychologist saying the following:

"It’s the best kept secret of modern science: 16 years of the Human Genome Project suggest that genes play little or no role in explaining differences in intelligence. While genes have been found for physical traits, such as height or eye colour, they are not the reason you are smarter (or not) than your siblings. Nor are they why you are like your high-achieving or dullard parents, or their forebears."

But this "missing heritability problem" is not at all "the best kept secret of modern science." There's another type of "missing something" problem that is much bigger and more important than such a "missing heritability problem." The problem I refer to may be called the "missing specifications problem."  The missing specifications problem is the problem that the arising of adult human bodies seem to require at least six extremely complex specifications that are nowhere to be found in the human body. 

Not long after DNA was discovered about the middle of the twentieth century, scientists and science writers began spreading a false idea about DNA: the idea that DNA contains a specification for building an organism such as a human.  There are various ways in which this false idea is stated, all equally false:

• Many described DNA or the genome as a blueprint for an organism.
• Many said DNA or the genome is a recipe for making an organism.
• Many said DNA or the genome is a program for building an organism, making an analogy to a computer program.
• Many claimed that DNA or genomes specify the anatomy of an organism. 
• Many claimed that genotypes (the DNA in organisms) specify phenotypes (the observable characteristics of an organism).
• Many claimed that phenotypes (the observable characteristics of an organism) are "expressions" of genotypes (the DNA in organisms). 
• Many claimed that genotypes (the DNA in organisms) "map"  phenotypes (the observable characteristics of an organism) or "map to" phenotypes.
• Many claimed that DNA contains "all the instructions needed to make an organism."
• Many claimed that there is a "genetic architecture" for an organism's body or some fraction of that body. 
• Many claimed that DNA or its genes "guide," "direct" or "control" the nine-month process by which a zygote progresses to become a full-sized human baby. 
• Using a little equation,  many claimed that a "genotype plus the environment equals the phenotype," a formulation as false  as the preceding statements, since we know of nothing in the environment that would cause phenotypes to arise from genotypes that do not specify such phenotypes. 

There was never any justification for making any such claims. The only coding system that has ever been discovered in DNA is a system allowing only low-level chemical information to be specified.  That coding system is known as the genetic code, and it is merely a system whereby certain combinations of nucleotide base pairs in DNA stand for amino acids.  So a section of DNA can specify the amino acids that make up a protein molecule. But no one has ever discovered any coding system by which DNA could specify anything larger than a protein molecule. 

The Genetic Code

No one ever discovered any coding system in DNA by which parts of DNA can specify high-level anatomy such as the arrangement of parts in an organ, or a skeletal structure, or an overall body appearance.  No one has even discovered any coding system in DNA by which the structure of cells can be specified.  The human body has at least 200 types of cells, and the structure of none of these cell types is specified by DNA. DNA does not even specify the structure of organelles that are the building components of cells.

If you ponder the simple fact that blueprints don't build things, you can start to get an idea of how nonsensical is the claim that a human arises because a DNA blueprint is read.  Blueprints have no power of construction.  When buildings are built with the help of blueprints, it is because intelligent agents read the blueprints to get an idea of what type of construction work to do, and because intelligent agents then follow such instructions. But there is nothing in the human body below the neck with the power to understand and carry out instructions for building a body if they happened to exist in DNA. 

Consider what goes on when you read a web page at a complicated site such as www.facebook.com or www.buzzfeed.com.  What occurs is a very complicated interaction between two things: (1) a web page that is rather like a blueprint for how the page should look and act, and (2) an extremely complicated piece of software called a web browser, which is rather like a construction crew that reads the web's page blueprint (typically written in HTML), and then constructs very quickly a well-performing web page.  If the web browser did not exist, you would never be able to get a well-performing web page.  The construction of a three-dimensional human body would be a feat trillions of times more complicated than the mere display of a two-dimensional web page.  Just as it is never enough to have just a web page without a web browser,  having some DNA blueprint for building a body would never be enough to build a body.  You would also need to have some "body blueprint reader" that would be some system almost infinitely more complicated than a web browser, in order for a body as complex as a human body to get built.  

We have no evidence that DNA contains any instructions for building cells or anatomy, and we also have no evidence for the existence of any such thing as a "body blueprint reader" in the human body, capable of reading, understanding and executing incredibly complicated instructions for building a human body. When you consider the amount of organization in a human body, you may start to realize the gigantic absurdity of thinking that a human specification can be found in some molecule merely listing low-level chemical information. 

Let us look at some of the specifications that are not found in DNA or its genes.  The human body relies very much not just on 20,000+ types of protein molecules, but also thousands of teams of protein molecules known as protein complexes. But DNA and its genes do not specify how to make such protein complexes. The specification shortfall is illustrated in the schematic visual below. In this diagram and all similar diagrams in this post, the red "missing" word means merely "missing in the human body" rather than entirely nonexistent. 

At least a long book would be required for such a specification of how to make the protein complexes used by human bodies. It is now well-known that protein complexes often make up components so complex that they are often called "molecular machines."  Such molecular machines often resemble human machines, by having features such as motor-like parts or propeller-like parts.  An example of one of the very many extremely organized protein complexes in the human body is shown below. The structure has many moving parts.  

Another example of an extremely organized protein complex is shown below. The diagram (made by a scientist) refers to some of the parts as "propellers."

Another example of an extremely organized protein complex is shown below. 

See my post here which discusses some of the more complex protein complexes used in human bodies. There are many cases in which the human body uses some type of protein complex requiring many different proteins arranged in some special way to achieve some astonishing piece of engineering that is often called a molecular machine.  The failure of scientists to understand how these protein complexes form is shown by the quotes below:

•  "The majority of cellular proteins function as subunits in larger protein complexes. However, very little is known about how protein complexes form in vivo." Duncan and Mata, "Widespread Cotranslational Formation of Protein Complexes," 2011.
• "While the occurrence of multiprotein assemblies is ubiquitous, the understanding of pathways that dictate the formation of quaternary structure remains enigmatic." -- Two scientists (link). 
• "A general theoretical framework to understand protein complex formation and usage is still lacking." -- Two scientists, 2019 (link). 
• "Protein assemblies are at the basis of numerous biological machines by performing actions that none of the individual proteins would be able to do. There are thousands, perhaps millions of different types and states of proteins in a living organism, and the number of possible interactions between them is enormous...The strong synergy within the protein complex makes it irreducible to an incremental process. They are rather to be acknowledged as fine-tuned initial conditions of the constituting protein sequences. These structures are biological examples of nano-engineering that surpass anything human engineers have created. Such systems pose a serious challenge to a Darwinian account of evolution, since irreducibly complex systems have no direct series of selectable intermediates, and in addition, as we saw in Section 4.1, each module (protein) is of low probability by itself." -- Steinar Thorvaldsen and Ola Hössjerm, "Using statistical methods to model the fine-tuning of molecular machines and systems,"  Journal of Theoretical Biology.

Let us look at some more of the specifications that are not found in DNA or its genes.  The human body relies very much on cell organelles. Organelles are the basic building components of cells. Contrary to the misleading diagrams that make cells look thousands or millions of times simpler than they are, the more organized cells in the human body require thousands of different organelles of quite a few different types.  But nowhere does DNA or its genes tell how to make any type of organelle. The specification shortfall is illustrated in the schematic visual below.

Looking at the diagram below, from the scientific paper here, you might be able to get some idea of how complex and long a specification would be needed to specify organelles. A ribosome is the smallest type of organelles in a cell. But in its tiny size it manages to have a factory for making different proteins.

Below are some other types of cell organelles:

By looking at the number in the second column of the table below,  derived from a table on this page of the Human Protein Atlas, you can get an idea of how complex each organelle is. The larger the number in the second column, the more complex that organelle is. Lysosomes are relatively simple organelles, but organelles such as mitochondria and plasma membranes are vastly more complex. Each type of protein requires a special arrangement of hundreds of amino acids, which altogether involves a special arrangement of thousands of atoms. The more complex organelles in cells require a special arrangement of more than a million atoms. The arrangement involved is as special and as hard-to-achieve by chance as the arrangement of characters in a lengthy essay such as this blog post. 

ORGANELLE TYPE	NUMBER OF TYPES OF PROTEINS IN EACH ORGANELLE
Intermediate filaments	163
Actin filaments	237
Focal adhesion sites	138
Microtubules	262
Microtubule ends	6
Cytokinetic bridge	159
Midbody	53
Midbody ring	25
Cleavage furrow	1
Mitotic spindle	93
Centriolar satellite	194
Centrosome	396
Mitochondria	1121
Aggresome	19
Cytosol	4883
Cytoplasmic bodies	73
Rods & Rings	20
Endoplasmic reticulum	542
Golgi apparatus	1163
Vesicles	2238
Peroxisomes	23
Endosomes	17
Lysosomes	19
Lipid droplets	39
Plasma membrane	2074
Cell Junctions	330
Nucleoplasm	6166
Nuclear membrane	276
Nucleoli	1075
Nucleoli fibrillar center	311
Nucleoli rim	151
Nuclear speckles	493
Nuclear bodies	588
Kinetochore	6
Mitotic chromosome	74
Total number of types of proteins used in human cell organelles	13147

Then there are cells themselves. Cells like those in the human body are fantastically organized things. Human cells are so complex they have been compared to factories or cities in their complexity. Most of the cells in the human body somehow manage to achieve the marvel of cell reproduction. Given the number of well-organized parts in a cell, every time a human cell reproduces it is a marvel comparable to an automobile splitting up to become two different working automobiles. Obviously some great plan is needed to construct all of the different types of cells in the human body. But no such plan can be found in DNA or its genes, which know nothing about how to make a cell. The missing specification is illustrated schematically below:

Here is a relevant quote from a physicist Anthony Aquirre, from his "Cosmological Koans," page 338:

"The most elaborate and sophisticated human-designed machines, while quite impressive, are utter child's play compared with the workings of a cell: a cell contains on the order of 100 trillion atoms, and probably billions of quite complex molecules working with amazing precision. The most complex engineered machines -- modern jet aircraft, for example -- have several million parts. Thus, perhaps all the jetliners in the world (without people in them, of course) could compete in functional complexity with a lowly bacterium." 

Then there are organs. Organs such as eyes and ears and hearts and lungs and livers are enormously complex. But DNA and it genes have no specification for making any organ in a body. The situation is schematically depicted below:

In Table 1 of the paper "A comprehensive functional analysis of tissue specificity of human gene expression," we have the following list.  In the paper the table has the same title as below.  The genes referred to are not the total number of genes used in a particular organ or body part, but the "tissue-specific genes" used only by that organ or body part. So, for example, there are apparently 22 genes used only by the liver, and 484 genes used only by the testis.  Each gene corresponds to a different type of protein, typically with a unique arrangement of several hundred amino acid parts. The "housekeeping" genes are genes not used only by one organ or body part. The table helps give us an idea of how complex human organs are. 

 

Table 1: Number of housekeeping and tissue-specific genes

Housekeeping 2374

Liver 22

Skeletal muscle 37

Fetal liver 16

Testis 484

Placenta 38

Bone marrow 63

Skin 75

Adrenal gland 13

Prostate 14

Trachea 16

Small intestine 35

Peripheral blood lymphocytes 49

Mammary gland 16

Tonsil 24

Thymus 4

Spleen 14

Fetal kidney 5

Thyroid 7

Brain 34

Heart 26

Lung 16

Salivary gland 17

Ovary 15

Pancreas 20

Fetal thymus 8

Colon 9

Spinal cord 24

Retina 190

Kidney 17

Uterus 12

Fetal brain 61

Average 43.8

Average, somatic tissues 30.9

A specification for an organ would include not just a specification of how to construct the organ, but also a specification of how to perform the enormously complex biochemistry needed for the organ to properly function. For example, here is a description of some of the biochemistry needed for the proper working of an eye, taken from a biochemistry textbook:

1. "Light-absorption converts 11-cis retinal to all-trans-retinal, activating rhodopsin.
2. Activated rhodopsin catalyzes replacement of GDP by GTP on transducin (T), which then disassociates into T_a-GTP and T_by.
3. T_a-GTP activates cGMP phosphodiesterase (PDE) by binding and removing its inhibitory subunit (I).
4. Active PDE reduces [cGMP] to below the level needed to keep cation channels open.
5. Cation channels close, preventing influx of Na⁺ and Ca2⁺; membrane is hyperpolarized. This signal passes to the brain.
6. Continued efflux of Ca²⁺ through the Na⁺-Ca2⁺ exchanger reduces cytosolic [Ca²⁺].
7. Reduction of [CA²⁺] activates guanylyl cyclase (CG) and inhibits PDE; [cGMP] rises toward 'dark' level, reopening cation channels and returning V_m to prestimulus level.
8. Rhodopsin kinase (RK) phosphorylates 'bleached' rhodopsin; low [Ca²⁺] and recoverin (Recov) stimulate this reaction. Arrestin (Arr) binds phosphorylated carboxyl terminus, reactivating rhodopsin.
9. Slowly, arrestin dissociates, rhodopsin is dephosphorylated, and all-trans-retinal is replaced with 11-cis-retinal. Rhodopsin is ready for another phototransduction cycle."

Then there are organ systems. Some organs require elaborate systems much more complex than the organ itself. For example, the nervous system has not just a brain but also nerves that are spread out throughout the body, and exist abundantly in the spine. And hearts cannot do anything in isolation, but require a huge system of arteries, veins and capillaries to achieve the circulation of the blood.  But DNA and its genes do not specify either how to make organs or organ systems. The missing specification is depicted in the visual below:

Finally, building a body such as a human body requires a specification for the structure of the overall organism.  Such a specification would include things such as a specification of the skeletal structure (consisting of 200+ different bones in humans, and how they are connected), and a specification of the overall body structure, including muscles, arms, legs, hands, feet, fingers, toes and the head (as well as the arrangement of organs on the head).  The specification would include all of the many things needed for the human body to result in a mobile human capable of walking, running, swimming and jumping. No such specification is to be found in DNA or its genes. The situation is depicted by the visual below:

Appealing to a dubious claim of self-organization, a web page on a college biology department states, "We still only poorly understand how all these tiny molecules self-organize into much larger organelles, cells, and organisms." At least the statement lets us know how such things are not explained by anything found in DNA or genes. 

Do you think that a large mobile body such as a lion's body or a human body could just pop up without there being any kind of specification for such a body? Consider all of the functional  interdependence of the items below, and you may change your mind. 

Our biologists have senselessly failed to recognize the gigantic problem of these missing specifications.  Many of our biologists have lied and misled us about what is in DNA, by speaking as if DNA was a blueprint or program or recipe for making a human. But many other scientists have told us the truth about what DNA and its genes are not. Some of the statements of these biologists are below:

1. On page 26 of the recent book The Developing Genome, Professor David S. Moore states, "The common belief that there are things inside of us that constitute a set of instructions for building bodies and minds -- things that are analogous to 'blueprints' or 'recipes' -- is undoubtedly false."
2. Biologist Rupert Sheldrake says this "DNA only codes for the materials from which the body is constructed: the enzymes, the structural proteins, and so forth," and "There is no evidence that it also codes for the plan, the form, the morphology of the body."
3. Describing conclusions of biologist Brian Goodwin, the New York Times says, "While genes may help produce the proteins that make the skeleton or the glue, they do not determine the shape and form of an embryo or an organism." 
4. Professor Massimo Pigliucci (mainstream author of numerous scientific papers on evolution) has stated  that "old-fashioned metaphors like genetic blueprint and genetic programme are not only woefully inadequate but positively misleading."
5. Neuroscientist Romain Brette states, "The genome does not encode much except for amino acids."
6. In a 2016 scientific paper, three scientists state the following: "It is now clear that the genome does not directly program the organism; the computer program metaphor has misled us...The genome does not function as a master plan or computer program for controlling the organism; the genome is the organism's servant, not its master.
7. In the book Mind in Life by Evan Thompson (published by the Belknap Press of Harvard University Press) we read the following on page 180: "The plain truth is that DNA is not a program for building organisms, as several authors have shown in detail (Keller 2000, Lewontin 1993, Moss 2003)."
8. Developmental biologist C/H. Waddington stated, "The DNA is not a program or sequentially accessed control over the behavior of the cell."
9.  Scientists Walker and Davies state this in a scientific paper: "DNA is not a blueprint for an organism; no information is actively processed by DNA alone...DNA is a passive repository for transcription of stored data into RNA, some (but by no means all) of which goes on to be translated into proteins."
10. Geneticist Adam Rutherford states that "DNA is not a blueprint," a statement also made by biochemistry professor Keith Fox. 
11. "The genome is not a blueprint," says Kevin Mitchell, a geneticist and neuroscientist at Trinity College Dublin, noting "it doesn't encode some specific outcome."
12. "DNA cannot be seen as the 'blueprint' for life," says Antony Jose, associate professor of cell biology and molecular genetics at the University of Maryland, who says, "It is at best an overlapping and potentially scrambled list of ingredients that is used differently by different cells at different times."  
13. Sergio Pistoi (a science writer with a PhD in molecular biology) tells us, "DNA is not a blueprint," and tells us, "We do not inherit specific instructions on how to build a cell or an organ." 
14. Michael Levin (director of a large biology research lab) states that "genomes are not a blueprint for anatomy," and after referring to a "deep puzzle" of how biological forms arise, he gives this example: "Scientists really don’t know what determines the intricate shape and structure of the flatworm’s head."
15. Ian Stevenson M.D. stated "Genes alone - which provide instructions for the production of amino acids and proteins -- cannot explain how the proteins produced by their instructions come to have the shape they develop and, ultimately, determine the form of the organisms where they are," and noted that "biologists who have drawn attention to this important gap in our knowledge of form have not been a grouping of mediocrities (Denton, 1986; Goldschmidt, 1952; B. C. Goodwin, 1985, 1988, 1989, 1994; Gottlieb, 1992; Grasse, 1973; E. S. Russell...Sheldrake, 1981; Tauber and Sarkar, 1992; Thompson, 1917/1942)."
16. Biologist B.C. Goodwin stated this in 1989: "Since genes make molecules, genetics...does not tell us how the molecules are organized into the dynamic, organized process that is the living organism."
17. An article in the journal Nature states this: "The manner in which bodies and tissues take form remains 'one of the most important, and still poorly understood, questions of our time', says developmental biologist Amy Shyer, who studies morphogenesis at the Rockefeller University in New York City."
18. Timothy Saunders, a developmental biologist at the National University of Singapore says, "Fundamentally, we have a poor understanding of how any internal organ forms.”
19. On the web site of the well-known biologist Denis Noble, we read that "the whole idea that genes contain the recipe or the program of life is absurd, according to Noble," and that we should understand DNA "not so much as a recipe or a program, but rather as a database that is used by the tissues and organs in order to make the proteins which they need."
20. A paper by Stuart A. Newman (a professor of cell biology and anatomy) discussing at length the work of scientists trying to evoke "self-organization" as an explanation for morphogenesis states that "public lectures by principals of the field contain confidently asserted, but similarly oversimplified or misleading treatments," and says that "these analogies...give the false impression that there has been more progress in understanding embryonic development than there truly has been." Referring to scientists moving from one bunk explanation of morphogenesis to another bunk explanation, the paper concludes by stating, "It would be unfortunate if we find ourselves having emerged from a period of misconceived genetic program metaphors only to land in a brave new world captivated by equally misguided ones about self-organization."
21. Referring to claims there is a program for building organisms in DNA, biochemist F. M. Harold stated "reflection on the findings with morphologically aberrant mutants suggests that the metaphor of a genetic program is misleading." Referring to  self-organization (a vague phrase sometimes used to try to explain morphogenesis), he says, "self-organization remains nearly as mysterious as it was a century ago, a subject in search of a paradigm." 
22. Writing in the leading journal Cell, biologists  Marc Kirschner, John Gerhart and Tim Mitchison stated, "The genotype, however deeply we analyze it, cannot be predictive of the actual phenotype, but can only provide knowledge of the universe of possible phenotypes." That's equivalent to saying that DNA does not specify visible biological structures, but merely limits what structures an organism can have (just as a building parts list merely limits what structures can be made from the set of parts). 
23. At the Stack Exchange expert answers site, someone posted a question asking which parts of a genome specify how to make a cell (he wanted to write a program that would sketch out a cell based on DNA inputs).  An unidentified expert stated that it is "not correct" that DNA is a blueprint that describes an organism, and that "DNA is not a blueprint because DNA does not have instructions for how to build a cell." No one contradicted this expert's claim, even though the site allows any of its experts to reply. 
24. A paper co-authored by a chemistry professor (Jesper Hoffmeyer) tells us this: "Ontogenetic 'information,' whether about the structure of the organism or about its behavior, does not exist as such in the genes or in the environment, but is constructed in a given developmental context, as critically emphasized, for example, by Lewotin (1982) and Oyama (1985)."
25. Biologist Steven Rose has stated, "DNA is not a blueprint, and the four dimensions of life (three of space, one of time) cannot be read off from its one-dimensional strand."
26. Jonathan Latham has a master's degree in Crop Genetics and a PhD in virology. In his essay “Genetics Is Giving Way to a New Science of Life,” a long essay well worth a read, Latham exposes many of the myths about DNA. Referring to "the mythologizing of DNA," he says that "DNA is not a master controller," and asks, "How is it that, if organisms are the principal objects of biological study, and the standard explanation of their origin and operation is so scientifically weak that it has to award DNA imaginary superpowers of 'expression'” and 'control' to paper over the cracks, have scientists nevertheless clung to it?"
27. An interesting 2006 paper by six medical authorities and scientists tells us that "biochemistry cannot provide the spatial information needed to explain morphogenesis," that "supracellular morphogenesis is mysterious," and that "nobody seems to understand the origin of biological and cellular order," contrary to claims that such order arises from a reading of a specification in DNA. 
28. Keith Baverstock (with a PhD in chemical kinetics) has stated "genes are like the merchants that provide the necessary materials to build a house: they are neither the architect, nor the builder but, without them, the house cannot be built," and that "genes are neither the formal cause (the blueprint), nor the efficient cause (the builder) of the cell, nor of the organism."
29. Evolutionary biologist Richard Lewontin stated, "DNA is not self-reproducing; second, it makes nothing; and third, organisms are not determined by it." Noting that "the more accurate description of the role of DNA is that it bears information that is read by the cell machinery," Lewontin lamented the "evangelical enthusiasm" of those who "fetishized DNA" and misspoke so that "DNA as information bearer is transmogrified into DNA as blueprint, as plan, as master plan, as master molecule." In another work he stated "the information in DNA sequences is insufficient to specify even a folded protein, not to speak of an entire organism." This was correct: DNA does not even specify the 3D shapes of proteins, but merely their sequence of amino acids. 
30. In 2022 developmental biologist Claudio D. Stern first noted,  "All cells in an organism have the same genetic information yet they generate often huge complexity as they diversify in the appropriate locations at the correct time and generate form and pattern as well as an array of identities, dynamic behaviours and functions." In his next sentence he stated, "The key quest is to find the 'computer program' that contains the instructions to build an organism, and the mechanisms responsible for its evolution over longer periods." Since this was written long after the Human Genome Project had been completed, he thereby suggested that no such instruction program had yet been discovered in the genome (DNA). 
31. A 2024 article says, "Martínez Arias, 68, argues that the DNA sequence of an individual is not an instruction manual or a construction plan for their body...The Madrid-born biologist argues that there is nothing in the DNA molecule that explains why the heart is located on the left, why there are five fingers on the hand or why twin brothers have different fingerprints."
32. Two scientists said this: "We see no valid use for definitions of the genotype and phenotype in terms of blueprints, programs, or sets of instructions, and their realizations or manifestation....The program/manifestation metaphor is factually misleading, because it suggests that the genotype uniquely determines an organism’s phenotype. However, as is well known, all it does is specify an organism’s norm of reaction to environmental conditions (Rieger et al., 1991,Lewontin, 1992)."
33. A 2022 paper in the journal Science (one authored by more than ten scientists) says this: "Although the genome is often called the blueprint of an organism, it is perhaps more accurate to describe it as a parts list composed of the various genes that may or may not be used in the different cell types of a multicellular organism....The genome in and of itself does not provide an understanding of the molecular complexity of the various cell types of that organism."
34. A Duke University biologist and a Cornell University biologist have confessed this: " No information about the overall architecture of these body parts is present in the cells and tissues of the parts themselves, or in each organism’s genes."  
35. Physics PhD Eric Heden states, "The molecular coding within DNA, rich and vast as it is, falls impossibly short of being able to supply the informational guidance needed to supervise the development and moment-by-moment cellular activities of living organisms."
36. In their book "The Plausibility of Life: Resolving Darwin's Dilemma" (page 148)  biologists  Marc W. Kirschner and John C. Gerhart state, "DNA provides no instruction on where to place the proteins in the cell. There is no genetic information for large-scale cellular organization." 

Have these scientists recognized the enormity of the missing specifications problem, and its implications? Have these biologists realized that the missing specifications problem is an issue that overthrows the mechanistic and Darwinian knowledge boasts of biologists? In general, they have not. You might compare such scientists to some tower builder trying to build a ten-story structure, who realizes one day that his second floor and his foundation cannot support the weight of the third, fourth and fifth floors he has already built. The implication is that the tower is destined to collapse, but the tower builder fails to put two and two together to come to that conclusion.  Similarly, the missing specifications problem ultimately implies that the boasts of mechanistic and reductionist and Darwinist biologists are doomed to collapse, at least in the sense of a credibility collapse. But most of the scientists quoted above probably have not realized that yet. 

The diagram below illustrates the levels of organization in a human body, and which levels are not specified by anything in DNA or its genes. The diagram is one way of illustrating the missing specifications problem. 

The diagram above (and the first visual of this post) actually fail to fully represent the missing specifications problem, because neither of these visuals mentions that protein molecules are only half-specified by DNA and its genes. DNA and its genes specify which amino acids make up particular proteins, but  DNA and its genes do not specify the three-dimensional shapes of protein molecules, something necessary for their function. The claim that the three-dimensional shapes of protein molecules is an inevitable consequence of their amino acid sequence is a claim known as Anfinsen's Dogma. But this claim is not well-supported by observations, and there are strong reasons for rejecting it, as I discuss in my posts here. Scientists attempting to reproduce the experiment of Anfinsen trying to support his dogma have failed to reproduce his results, as I discuss in those posts.  Claims that the protein folding problem was solved by the AlphaFold2 software are incorrect. That software merely made some progress with a different problem: the protein folding prediction problem, the problem of how to predict the 3D shape of a protein from its amino acid sequence. The protein folding problem (the problem of how 3D shapes arise from 0ne-dimensional sequences of amino acids) is very much unsolved, and this is one aspect of the missing specifications problem. 

Whenever results can all be easily explained as accidents or chance effects, and whenever results do not require any very special and very improbable arrangement of parts that achieve functional ends, or when results are achieved only once or a few times, there may be no need to say that there must be a specification of the results somewhere. For example, the wind forms snow into random types of snow drifts, and there is no need to postulate that there are snow drift specifications. But whenever a result is achieved a huge number of times, and involves a very special arrangement and organization of very many parts of many different types that is necessary for achieving a functional end, and whenever so special and hard-to-achieve a functional organization of very many parts of many types is accidentally unachievable, then we should say: there must be a specification somewhere.  Each of the levels of organization listed above is a level of organization that is accidentally unachievable, and each of these levels of organization must be matched by some specification existing somewhere. But none of these specifications exist in the human body. 

 

Large biological organisms such as humans somehow get constructed according to the most elaborate and purposeful plans, but most of those plans can be found nowhere in the human body. And even if such plans were to be ever found in the human body,  they would not explain the physical construction of a human body so organized and internally dynamic, both  because the plans would be too complex for anything in the human body to understand, and because plans don't build things.  For example, blueprints do not build houses -- houses get built because intelligent house builders read blueprints and get ideas on how to build houses. 

The implications of the missing specifications problem are so large they can scarcely be overstated.  The person who very deeply ponders the missing specifications problem at sufficient length will tend to eventually suspect that biology is radically and thoroughly teleological from top to bottom, that claims of mostly accidental biological origins are gigantically incorrect, and that earthly biology must be driven by some purposeful agency beyond human fathoming, with such agency working continuously, rather than merely as some "way back when" type of thing. The probability that such suspicions are anathema to the great majority of biologists is no reason for avoiding such ideas, if deeply pondering the facts and their implications compel us to move in the direction of such ideas. The complete failure of neural explanations to credibly account for the main aspects of the human mind is something that should embolden us when pondering the need for a drastic rethinking of long-standing but never-justified claims in biology. 

There are two ways in which materialists try to prevent you from understanding the missing specifications problem. The first way is to make deceptive statements about DNA and genes, including false claims that DNA is a blueprint, recipe or program for making bodies. The scientist statements quoted above refute such deceptive claims. The second way in which materialists try to prevent you from understanding the missing specifications problem is to misrepresent the vast amount of hierarchical organization and internal dynamism and fine-tuned functional complexity of human bodies. This consists of various tricks to fool you into thinking that human bodies are a million times simpler than they are. Among these tricks are the tricks of publishing cell diagrams that depict cells  as a million times simpler than they are, or diagrams depicting protein molecules as hundreds of times simpler than they are, or diagrams or statements that fail to mention protein complexes or organelles or cells, leading people to think the very incorrect idea that organism bodies or cells are directly made from proteins, or profoundly misleading statements describing your body as "star stuff" using the term "stuff" referring to something disorganized . The main trick of this type is just a failure of adequate description, so that people are never educated about how their bodies are feats of precise engineering more impressive than any objects humans have constructed. 

Humans know how to make cities. There is not a nation or a corporation in the world that could ever construct a living human body even as small as a baby from low-chemical materials, or get even a tenth of the way to such a goal. Given the missing specifications described above, every time a new human body comes fully into existence, it is a miracle of construction far more impressive than a million piles of bricks, pipes, doors and boards magically turning into a city, when there are no builders around,  No appeal to evolution can overcome this difficulty, because Darwinian evolution refers to what supposedly occurred over the span of many generations long ago, not what happens during the nine months of a human pregnancy. 

Below are some relevant quotes:

• "Yet while these are several examples of well-understood processes, our study of animal morphogenesis is really in its infancy." -- David Bilder and Saori L. Haigo1, "Expanding the Morphogenetic Repertoire: Perspectives from the Drosophila Egg." 
• "Fundamentally, we have a poor understanding of how any internal organ forms." -- Timothy Saunders, developmental biologist (link).
• "An adult human body is made up of some 30 to 40 trillion cells, all of which stem from a single fertilized egg cell. The process by which the right cells appear to arrive in their right numbers at the right time at the right place -- development -- is only understood in the roughest of outlines." -- Five scientists (link). 
• "Biochemistry cannot provide the spatial information needed to explain morphogenesis...Supracellular morphogenesis is mysterious...Nobody seems to understand the origin of biological and cellular order."  -- Six medical authorities (link).
• "Despite the centrality of multicellularity and cell differentiation to animal biology, their origins are little understood." -- Two cell biologists (link). 
• "We have little understanding of the processes that allow cells to become different." -- Two scientists, 2019 (link).